ID: 949521415

View in Genome Browser
Species Human (GRCh38)
Location 3:4858021-4858043
Sequence ATGCTGTTCTAGAAGAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 6, 3: 21, 4: 229}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949521415_949521416 2 Left 949521415 3:4858021-4858043 CCTGTTTTCTTCTAGAACAGCAT 0: 1
1: 0
2: 6
3: 21
4: 229
Right 949521416 3:4858046-4858068 TACAATATAACTTTCTGTTATGG 0: 1
1: 0
2: 3
3: 22
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949521415 Original CRISPR ATGCTGTTCTAGAAGAAAAC AGG (reversed) Intronic
901355614 1:8645296-8645318 ATGCAGTTCAAGAAGAACAGAGG - Intronic
904672699 1:32178143-32178165 ATGCTTTTCTAGAAATAATCAGG + Intergenic
906270814 1:44476912-44476934 ATGCTGGTCCAGAAGCAAGCAGG + Intronic
906888567 1:49681355-49681377 ACATTGTTCTAGAAGAAAAGGGG + Intronic
906965738 1:50454695-50454717 ATGCTGTTTTAGCAAAAGACAGG - Intronic
908619709 1:65963808-65963830 ATCCTGTTTTAGAAACAAACTGG + Intronic
908693626 1:66811297-66811319 ATGCTTTTATAGAAGAAAAATGG + Intergenic
909031870 1:70550896-70550918 TTGCTTTTCTAGAAGTAAGCTGG - Intergenic
909273669 1:73656975-73656997 ATGCTTTTCTACAAGAAAATGGG + Intergenic
911048833 1:93652167-93652189 ATTCTGTTCTGAAAGCAAACAGG + Intronic
911602960 1:99867117-99867139 ATACTTTTTTAAAAGAAAACTGG - Intronic
911888614 1:103337752-103337774 TTTGTGTTCTAGAAGAAAAAAGG - Intergenic
913106464 1:115618115-115618137 ATCCTGTTCTAGGAGAAATGAGG - Intergenic
917078614 1:171233703-171233725 ATGCTCTTAGATAAGAAAACAGG + Intergenic
917112778 1:171567845-171567867 AAGTTGTTCTGGAAGAAAGCAGG - Intronic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
918123879 1:181565429-181565451 TTTCTCTTCCAGAAGAAAACTGG - Intronic
918365408 1:183803076-183803098 ATGCTGTTCTGCAAAAAAAGAGG - Intronic
919431936 1:197504759-197504781 ATGCAGTTCTAAAATAAAATTGG - Intronic
919633494 1:199981868-199981890 ATCCTGCTCAAGAAAAAAACAGG + Intergenic
919969732 1:202567251-202567273 CTGCTGCTCTAAAAGAAAAATGG + Intronic
921423551 1:214976513-214976535 ATGCTGTTCTAGAAGCAAGGAGG - Intergenic
921558337 1:216626437-216626459 ATGGTGTGCTAGAAGAGATCTGG - Intronic
921942257 1:220854218-220854240 ATGGTGATTTAGAAGAAAGCTGG - Intergenic
923299065 1:232623733-232623755 AAGCAATTCTGGAAGAAAACAGG + Intergenic
1062785291 10:259858-259880 ATGGAGTTTTAGAGGAAAACAGG + Intergenic
1063212493 10:3893759-3893781 GTGATGTTCTCGTAGAAAACAGG - Intergenic
1063597146 10:7445759-7445781 CTGTTGTTCTAGAAGAAAAAAGG - Intergenic
1064222356 10:13452256-13452278 ATGCTGTCATATATGAAAACCGG - Intronic
1064248232 10:13686561-13686583 TTTCTGTTCTGGGAGAAAACAGG - Intronic
1064986362 10:21214857-21214879 ATTCTTTTCTAAAAGAACACAGG - Intergenic
1065139535 10:22706901-22706923 ATGATGTTCTACTACAAAACAGG + Intronic
1066047617 10:31607094-31607116 AAGCTGTACTAGAAGCAATCAGG + Intergenic
1066197752 10:33117642-33117664 ATGGTGTTCTAGAAATAAACTGG - Intergenic
1066421587 10:35268988-35269010 ATGCTGTTCATGAAGATAATGGG - Intronic
1068669898 10:59711815-59711837 ATACTCTTCTAAAAGAAATCTGG - Intronic
1069101141 10:64322361-64322383 ATGCTGAACTAGAGGAGAACAGG - Intergenic
1069246921 10:66218197-66218219 CTACTGTTCTAGAAAAAAACAGG - Intronic
1069758761 10:70792934-70792956 ATTCCATTCTAGAAGAAAAAGGG - Intergenic
1070387009 10:75934821-75934843 AAACTGTTCTAAAAGAAAAAGGG - Intronic
1071057314 10:81527034-81527056 ATGATGTCCAAGAAGAAAAGGGG + Intergenic
1071964359 10:90836960-90836982 AAGCTGTTGTAGTAGAAGACAGG - Intronic
1072362780 10:94676159-94676181 ATGGTGTTCTACAACAAATCAGG + Intergenic
1073899119 10:108198717-108198739 CTGCTTTTCTGGAAGAAATCTGG - Intergenic
1074679631 10:115891290-115891312 ATAGTGTTCTGGAAGAAAAAGGG + Intronic
1076199125 10:128544341-128544363 GTGCTGTTTTAAAAGAAAAAAGG - Intergenic
1078293459 11:10040548-10040570 ATCCTGTACTGGAAGAAAAAAGG + Intronic
1079151649 11:17905332-17905354 ATGCTATTCTGTGAGAAAACTGG - Intronic
1080026809 11:27623985-27624007 TTGCTCTTCAAGAAGAAAACAGG + Intergenic
1081414577 11:42798948-42798970 CTAAAGTTCTAGAAGAAAACCGG - Intergenic
1083247351 11:61439491-61439513 ATTCTGTTATCGATGAAAACTGG + Intronic
1086055984 11:82647015-82647037 ATGCTATGGAAGAAGAAAACAGG + Intergenic
1087144851 11:94801069-94801091 GTGCTGTTCTAGGAGAGAAATGG + Intronic
1087455039 11:98374094-98374116 TTTCTGTTGTGGAAGAAAACTGG - Intergenic
1088164476 11:106916972-106916994 ATGTTGTTCTAGGAGCTAACTGG + Intronic
1089521100 11:119064186-119064208 ATGCGGTTATTGACGAAAACTGG + Intergenic
1090060974 11:123464008-123464030 GAGCTGTTTTAGAAGATAACAGG + Intergenic
1093000285 12:13988542-13988564 ATGCTACTCTAGAAGATAAAAGG - Intergenic
1093895051 12:24565217-24565239 ATACTGTGCAAGAAGCAAACAGG + Intergenic
1094090844 12:26647408-26647430 ATGCTGTTGTAAAAGAAAAAAGG + Intronic
1095634170 12:44412657-44412679 ATTCTGTTGTAGAAGCAAAGTGG - Intergenic
1097884967 12:64719950-64719972 ATGCTGTTCTTGAAGGCAAAGGG - Intronic
1101263806 12:103063683-103063705 TTGTAGGTCTAGAAGAAAACAGG - Intergenic
1101561695 12:105863310-105863332 ATGGTGTTCTAGATGAAGCCTGG - Intergenic
1102531777 12:113551913-113551935 ATGCTGTTATGGAAAGAAACAGG - Intergenic
1106667060 13:31863065-31863087 ATGCTGCTCTAGGACAAAAGAGG - Intergenic
1108020424 13:46122308-46122330 ATGCTGTCCTAGAAGAATAAAGG - Intergenic
1110675113 13:78233318-78233340 ATGCTGTTCTAGATGGATATGGG - Intergenic
1113214251 13:108019891-108019913 ATTCAGTTCAAGAAGAAAAATGG + Intergenic
1115041250 14:28931765-28931787 ATGCTGTTGTAGAAAAATCCAGG + Intergenic
1115365073 14:32548739-32548761 ATGATACTATAGAAGAAAACTGG - Intronic
1115849806 14:37582469-37582491 ATGCTGCTCTATAAGACAAAGGG + Intergenic
1116204220 14:41841088-41841110 TTGCTATTGTAGAAGAAAAGTGG - Intronic
1116373576 14:44168367-44168389 ATGCTGTTCAAGAAGAAATCTGG - Intergenic
1116377401 14:44220945-44220967 ATAAAGTTCTAGAAGTAAACTGG + Intergenic
1117229145 14:53697434-53697456 ATGATGTTAAATAAGAAAACAGG + Intergenic
1118945866 14:70386981-70387003 ATTCAGTTCTAAAAGAAAACAGG + Intronic
1119626655 14:76182882-76182904 AAGCTGTCATAGAAGACAACAGG + Intronic
1119936252 14:78594757-78594779 CTCCTGTTCCAGGAGAAAACTGG + Intronic
1120078130 14:80183422-80183444 ATGTTTTTCAAGAAGAAAAAAGG + Intergenic
1120510522 14:85408231-85408253 ATGTTATTCTAGAGGAAAAATGG + Intergenic
1122042016 14:98994921-98994943 ATTTCGTTCTAGAAGAAAACAGG + Intergenic
1123554333 15:21411884-21411906 ATGCTTATTAAGAAGAAAACTGG + Intronic
1124932833 15:34138782-34138804 ATTCTGTTATAGAATAAAAAAGG + Intergenic
1125542836 15:40480539-40480561 TTCCTTTTCTAGAAGAAACCTGG + Intergenic
1126209855 15:46089534-46089556 ATGCTGCTCTAGCAGACAATAGG - Intergenic
1126668956 15:51098922-51098944 ATGCTATTATAGCAGAAAATTGG - Intronic
1127509565 15:59626519-59626541 GTGATGTTCTGGAAGCAAACAGG + Intronic
1127602204 15:60549015-60549037 ATGGTCTTGTGGAAGAAAACAGG + Intronic
1128093378 15:64934121-64934143 AGGTTTTTCTAGAAGGAAACAGG - Exonic
1130170472 15:81506991-81507013 AAGATATTCTAGCAGAAAACAGG + Intergenic
1132426275 15:101720076-101720098 ATGATGTGCTAGGAGAAAACAGG - Intronic
1133645747 16:7763010-7763032 ATGCTCTACTAGAAGACAAAAGG - Intergenic
1135007329 16:18838022-18838044 CAGCTACTCTAGAAGAAAACAGG + Exonic
1137633664 16:49966882-49966904 ATGATGTACTAGAAGAAATGAGG - Intergenic
1138124267 16:54425991-54426013 ATGTTGTTCAACAAGAAAAAGGG - Intergenic
1138933754 16:61694259-61694281 GTGCTTTTCTAGAAGGAAAGTGG + Intronic
1142682732 17:1559998-1560020 CTGCTGTTCTTGAAGATAAAAGG - Intronic
1144765792 17:17731732-17731754 ATGCTGGTCTAGAGGGAAGCAGG + Intronic
1149281887 17:55114364-55114386 GATCTGTTCTAAAAGAAAACAGG + Intronic
1149771176 17:59322310-59322332 TTGCTGCTGGAGAAGAAAACTGG - Intergenic
1150808754 17:68339602-68339624 TTGATATTCTACAAGAAAACTGG - Intronic
1151017595 17:70575002-70575024 ATTTTATTCTAGAAGAAAATAGG + Intergenic
1151315619 17:73320276-73320298 AGACTCTTCTAGAAGAAAATGGG + Intergenic
1154092261 18:11376615-11376637 ATGCTGGAATTGAAGAAAACTGG - Intergenic
1156823500 18:41401603-41401625 ATAAGGCTCTAGAAGAAAACAGG + Intergenic
1156902658 18:42319498-42319520 CTGCTGATCTAGAAGAGAAGAGG + Intergenic
1157406511 18:47426431-47426453 ATGCTGACCTAGAGTAAAACTGG - Intergenic
1158432021 18:57397776-57397798 GTCCGGTTCTAGAAGAAAATGGG + Intergenic
1164995391 19:32717508-32717530 ATGCAGTTCTATAAGAAAACTGG - Intergenic
1165173182 19:33907231-33907253 ATGCTGATCTAGAAGTACAATGG + Intergenic
1165555327 19:36626118-36626140 ATTCTTTTCTAGAAGAAGATGGG + Exonic
1165565100 19:36718936-36718958 ATTCTTTTCTAGAAGAAAACTGG + Exonic
927582222 2:24262063-24262085 ATGGTGATATAGAAGAAACCAGG - Intronic
932101253 2:68901065-68901087 GTGCTGTTCTAGGAGAAAGTGGG + Intergenic
932815534 2:74858298-74858320 ATGCTCATCTAGAATCAAACTGG - Intronic
934667259 2:96181158-96181180 CTACTGTTCTAGATGAAAAGTGG + Intergenic
935250794 2:101258510-101258532 TTTCTGTTTTAGAAGAAAGCTGG + Intronic
936001304 2:108832876-108832898 CTGCTGTTCTAGAACTATACTGG + Intronic
938044741 2:128108075-128108097 ATGCTGTTCTTTAAGAGCACTGG - Intronic
938660025 2:133476885-133476907 AAGCTGTTCTGAAAGAAAAGAGG - Intronic
939731595 2:145791319-145791341 TTGCTGTTCTAGAAAACAAGGGG - Intergenic
939904384 2:147892673-147892695 TTGTTGTAGTAGAAGAAAACTGG + Intronic
940609778 2:155975398-155975420 CTGTTGTTTTAGAAGAAAAGAGG + Intergenic
940909979 2:159202013-159202035 AGGCTCTCCTAGCAGAAAACTGG - Intronic
941567562 2:167127961-167127983 GAGTTGATCTAGAAGAAAACTGG - Intronic
943467787 2:188250819-188250841 ATGCTCTTCTAAAAGAAAGGAGG + Intergenic
944408029 2:199407562-199407584 ATGATGATCTAGAAAAACACAGG + Intronic
944463681 2:199978890-199978912 ATGCTGTAGTAAAATAAAACAGG - Intronic
945478093 2:210309997-210310019 ATGCTGTAACAGAAGAGAACAGG - Intronic
945485419 2:210389862-210389884 ATGCATTTCTAGCAGAAAAGTGG + Intergenic
946543543 2:220712351-220712373 GTGCTGTGCTAGAGGACAACTGG + Intergenic
946616738 2:221518078-221518100 ATTCTGTTCTGGGAGGAAACAGG - Intronic
1170621031 20:17996196-17996218 ATGCTGTTCCAAAAAAAAAATGG - Intronic
1171470476 20:25366651-25366673 AAGAAGTACTAGAAGAAAACAGG - Intronic
1171949029 20:31404583-31404605 GTGCTGGTCTAGAAGAAAACAGG + Intergenic
1173518559 20:43682478-43682500 ATGCTCTCCTAGAAAAAAGCAGG + Intronic
1178187429 21:30239568-30239590 TTGCTGTTCTGAAAAAAAACAGG - Intergenic
1178423300 21:32459042-32459064 GTGCTGTGTTAGAAGAACACAGG - Intronic
1179078533 21:38147704-38147726 CTGCTGTCATAGAACAAAACTGG - Intronic
949521415 3:4858021-4858043 ATGCTGTTCTAGAAGAAAACAGG - Intronic
949655278 3:6210708-6210730 ATGCTATTTTAGAAGAAAGATGG + Intergenic
949843301 3:8343546-8343568 CTGGTGTTCTGGAAGAAAAATGG + Intergenic
949844670 3:8357434-8357456 ATTATGTTCTAGGTGAAAACTGG - Intergenic
951148124 3:19253866-19253888 ATTATGTTCTACAAGAAAAACGG + Exonic
951946192 3:28139450-28139472 ATCCTGTTCTAGGAGAAACGAGG - Intergenic
955664700 3:61337960-61337982 ATGTTGTTATAGAACCAAACTGG + Intergenic
956447939 3:69344138-69344160 ATGCTGTCCATGAAGAAATCAGG - Intronic
957691444 3:83576179-83576201 AAGCTTTTATAGAAGAAAAGTGG - Intergenic
957812909 3:85251114-85251136 TTACTGTTCTAGTAGAAAAATGG - Intronic
959204324 3:103284983-103285005 ATTCTATTCTTGAACAAAACTGG + Intergenic
959800662 3:110491252-110491274 ATGCTTTTCAAGATGAAAAAAGG - Intergenic
960356449 3:116659517-116659539 CTGCTAATGTAGAAGAAAACTGG - Intronic
962293975 3:134163603-134163625 ATGCTGCACTAAAAGAAAAAAGG - Intronic
963196808 3:142541285-142541307 GTACTGTTCTAGATGAATACTGG - Intronic
963640049 3:147849781-147849803 ATGATGTCTTTGAAGAAAACTGG + Intergenic
963661078 3:148129704-148129726 TTACAGGTCTAGAAGAAAACAGG - Intergenic
964699876 3:159554226-159554248 GTGCTGTTCTGAATGAAAACTGG + Intronic
966142713 3:176773921-176773943 AAGCTATCCTAGAACAAAACTGG + Intergenic
966921072 3:184611728-184611750 ATTCTGTCCTAGAAGGAAATTGG + Intronic
971639530 4:29113486-29113508 ATGCTGTTCTAAACTTAAACTGG - Intergenic
971736832 4:30464334-30464356 AGGCAGGTCTAGCAGAAAACAGG + Intergenic
975290075 4:72667317-72667339 ATTTTGTTGTAGAAAAAAACGGG - Intergenic
975562678 4:75722242-75722264 ATGCTGCTGGGGAAGAAAACAGG + Intronic
977809511 4:101344393-101344415 ATAATATTCTACAAGAAAACAGG + Intronic
978187756 4:105877608-105877630 AGGATGCTCTTGAAGAAAACTGG - Intronic
978260374 4:106749806-106749828 GTTCTTTTCTAGAAGGAAACAGG - Intergenic
978630660 4:110739988-110740010 ATGCTGTTCTACAAGTAGAGAGG - Intergenic
980483338 4:133419211-133419233 ATGCTGTTATAGATGTAAAGAGG + Intergenic
980531237 4:134058086-134058108 ATGCTGCTCAAGAATAAAACAGG + Intergenic
981366759 4:143912815-143912837 ATGCTGTTCTTGTTGCAAACTGG + Intergenic
981376556 4:144023047-144023069 ATGCTGTTCTTGTTGCAAACTGG + Intergenic
981387065 4:144144392-144144414 ATGCTGTTCTTGTTGCAAACTGG + Intergenic
981768012 4:148274225-148274247 ATGGTGTTCAAAAAGAAAAATGG + Intronic
983316973 4:166144929-166144951 ATGCTGTGGTAGAAGGAACCAGG + Intergenic
983417732 4:167480053-167480075 ATGCTGTTCTGGAAGGTCACGGG + Intergenic
985065962 4:186122187-186122209 AGGCTGTTCTAAAAGATAACTGG + Intronic
986714293 5:10511589-10511611 TTGCTGTTCTAGAATACCACAGG + Intronic
988153040 5:27412138-27412160 ATGATGTTTGAGAAGAGAACAGG - Intergenic
988734455 5:34007117-34007139 ATGCTGTTTTAGAAGGAAGAAGG + Intronic
988931001 5:36035569-36035591 TTCCTGTTCTTCAAGAAAACAGG + Exonic
990662797 5:58037122-58037144 GTGCTGCTCTAGAAGAAAATAGG + Intergenic
991202324 5:64008701-64008723 AAGATGTTGTAGAAAAAAACAGG - Intergenic
991377628 5:65983200-65983222 ATTCTGATCAAGAAGAAAGCTGG - Intronic
992272392 5:75078433-75078455 ATGCTTTTCCAGAAAAAAATAGG - Intronic
992485209 5:77188391-77188413 ATGCTACTCTGGAATAAAACTGG - Intergenic
993602273 5:89942004-89942026 ATTTTATACTAGAAGAAAACAGG + Intergenic
994571438 5:101519400-101519422 ATGCTGTATTAGAAAAAAACAGG + Intergenic
995819500 5:116213098-116213120 ATGGTATTCTAGCAGAAAGCAGG - Intronic
995969948 5:117956203-117956225 ACAGTGTTCTAGAAGAAAGCTGG + Intergenic
996516080 5:124371016-124371038 ATGATGTTCCAGAAAAAAATAGG - Intergenic
998396840 5:141824147-141824169 ATTCTGCCCTAGAAGAAACCCGG + Intergenic
998460427 5:142305846-142305868 TTTCTGTTGTAGAAGAAATCAGG + Intergenic
998941861 5:147292323-147292345 GTACTGTTACAGAAGAAAACAGG + Intronic
999845280 5:155472527-155472549 TTGCTGTTCAAGGAGAAAAAGGG + Intergenic
1000141446 5:158408129-158408151 ATACTATTATATAAGAAAACTGG - Intergenic
1004202188 6:13559122-13559144 ATGCTGTTCTCAGAGAAAAAGGG - Intergenic
1006061350 6:31422257-31422279 ATGCTGTTCTAAAAGAAAAAAGG + Intergenic
1006644716 6:35508225-35508247 AGGTTGTTCCAGAAGAAACCTGG + Intronic
1006960391 6:37924499-37924521 ATGATGTGAAAGAAGAAAACAGG + Intronic
1007122754 6:39396937-39396959 ATGCTTTTCTAAAAGGGAACAGG - Intronic
1007283855 6:40733239-40733261 ATGCTATTCTACAACAAAAAGGG + Intergenic
1008370068 6:50721890-50721912 ATGATGTTCTTGAAGAAATATGG + Intronic
1011090064 6:83587895-83587917 ATATTTTTCTATAAGAAAACAGG + Intronic
1012659989 6:101875965-101875987 ATGTAATTCTAGAAGAAAACAGG - Intronic
1015905766 6:138115005-138115027 ATGCTGGTTTAGAAGAAGAAAGG - Intergenic
1016680962 6:146828910-146828932 TTGCTGTTATCGAACAAAACTGG - Intergenic
1018527266 6:164726990-164727012 AAGCTTTTCTTTAAGAAAACTGG - Intergenic
1020844673 7:13267884-13267906 ATGAAGTTGTAGAAGAAAAAAGG + Intergenic
1022404916 7:30079867-30079889 ATTTAGTTCTTGAAGAAAACTGG - Exonic
1023655132 7:42412020-42412042 ATGATTTGATAGAAGAAAACTGG - Intergenic
1024319030 7:48046867-48046889 ATGCTTATCTAGAGGAAAACTGG + Intronic
1024644731 7:51361560-51361582 CTGCTTTTCTAGAAGAAATGAGG + Intergenic
1024827588 7:53410082-53410104 ATGCTGTCCTTGAAGAAAATAGG - Intergenic
1024897779 7:54280262-54280284 ATGCCGTTGTAGAAAAAAACAGG - Intergenic
1028003577 7:85533000-85533022 ATGCTATTTTAGAAAACAACAGG - Intergenic
1028658970 7:93245238-93245260 ATACTGATTAAGAAGAAAACAGG + Intronic
1030137182 7:106265739-106265761 ATACTGTACTAGAAGAATAGAGG - Intronic
1030667795 7:112300248-112300270 AAGCTCTTCAAAAAGAAAACTGG - Intronic
1030747628 7:113186977-113186999 ATGCTGTTCTAAAGTAAAAGTGG + Intergenic
1031941792 7:127797276-127797298 ATGCTGATCTACTAGAAACCTGG - Intronic
1032609304 7:133393963-133393985 AGGCTGGTCTAGGAGAAAGCAGG - Intronic
1035246846 7:157568082-157568104 ATGCTTTTGTAGGAGAAAATTGG + Intronic
1039332757 8:36557381-36557403 ATGCTTTTCTAGAAGGATATGGG - Intergenic
1039802383 8:40970603-40970625 ACACTGTTGTAGAAAAAAACAGG + Intergenic
1040741615 8:50582640-50582662 ATACAATTCTAGAAAAAAACAGG + Intronic
1041739790 8:61145980-61146002 ATGCTGGGATAGAAGGAAACTGG - Intronic
1044336675 8:90992147-90992169 ATGTTATTTTAGAAGAAAAAAGG - Intergenic
1045804421 8:106140622-106140644 ATGCTGATAAAGCAGAAAACAGG + Intergenic
1048145167 8:131834608-131834630 ATGCAGATCTGGCAGAAAACAGG + Intergenic
1055474825 9:76652191-76652213 ATGCTGTGTTACAAGAAACCTGG - Intronic
1055960338 9:81814551-81814573 ATGCTCTTCTGGGAGAAAACAGG - Intergenic
1056808816 9:89748644-89748666 ATCCTGTTTTAAAAGAAAAGTGG + Intergenic
1057009766 9:91590789-91590811 CTGCTGTTCTGGAAGCACACTGG - Intronic
1059397582 9:114047938-114047960 CTGCTGTTGTAGAAGAGAAGTGG + Exonic
1059938961 9:119339088-119339110 CTCTTGGTCTAGAAGAAAACAGG - Intronic
1061679078 9:132233881-132233903 AAGCTGTTTCAGAAGAAAAAAGG + Intronic
1061952051 9:133942096-133942118 ACGGTGCTCTAGAGGAAAACCGG + Intronic
1186639440 X:11439834-11439856 ATATTGTTCTAGAAGAAATGGGG - Intronic
1187416398 X:19097003-19097025 GTGCTTTTCTAGAAGAGAAGAGG + Intronic
1187668916 X:21649254-21649276 ACTCAGTTCTAGGAGAAAACAGG + Intronic
1188597942 X:31923894-31923916 ACGCTATTATATAAGAAAACGGG - Intronic
1189694095 X:43645838-43645860 AGGCTGTTTTACAAGACAACTGG - Intergenic
1189743092 X:44141963-44141985 ACACTTTTCTAGGAGAAAACCGG + Intergenic
1190258113 X:48779814-48779836 CCGCTGCTTTAGAAGAAAACAGG + Intergenic
1191227644 X:58061521-58061543 ATGCTGCTTTAGTAAAAAACAGG + Intergenic
1191845496 X:65544415-65544437 ATGCTGTACTAGAAGCAATGGGG + Intergenic
1193500002 X:82263694-82263716 ATACTATTCTAGAAGAATAAGGG - Intergenic
1194247668 X:91536033-91536055 ATGCAGATCTAGAAGTAGACAGG - Intergenic
1194779150 X:98001925-98001947 ACTCTGTTCTAGAAGAAAACAGG + Intergenic
1195596611 X:106698454-106698476 ATGTTTTTCTAGAAGTAAAAGGG + Intronic
1196699732 X:118655101-118655123 AAGCTGTTATAAAAGAAGACTGG + Intronic
1196848403 X:119915054-119915076 ATGTTGTTCTAGAAGCCAAATGG - Intronic
1198454395 X:136801541-136801563 ATAATGCTCTGGAAGAAAACAGG - Intergenic
1199239113 X:145526142-145526164 AAGCTGGGCTAGAAGGAAACTGG + Intergenic
1200566688 Y:4777563-4777585 ATGCAGATCTAGAAGTAGACAGG - Intergenic
1202056632 Y:20840618-20840640 ATACTGTAATAGAATAAAACTGG - Intergenic