ID: 949522562

View in Genome Browser
Species Human (GRCh38)
Location 3:4870015-4870037
Sequence TTACTTTGAAGCTGTCCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 143}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949522560_949522562 18 Left 949522560 3:4869974-4869996 CCTTGAGAACACGAAGTTTTTTG 0: 1
1: 0
2: 1
3: 12
4: 199
Right 949522562 3:4870015-4870037 TTACTTTGAAGCTGTCCTGATGG 0: 1
1: 0
2: 2
3: 9
4: 143
949522559_949522562 19 Left 949522559 3:4869973-4869995 CCCTTGAGAACACGAAGTTTTTT 0: 1
1: 0
2: 1
3: 14
4: 186
Right 949522562 3:4870015-4870037 TTACTTTGAAGCTGTCCTGATGG 0: 1
1: 0
2: 2
3: 9
4: 143
949522558_949522562 27 Left 949522558 3:4869965-4869987 CCATGGGTCCCTTGAGAACACGA 0: 1
1: 0
2: 0
3: 12
4: 84
Right 949522562 3:4870015-4870037 TTACTTTGAAGCTGTCCTGATGG 0: 1
1: 0
2: 2
3: 9
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949522562 Original CRISPR TTACTTTGAAGCTGTCCTGA TGG Intronic
902154098 1:14469691-14469713 TTCCCTTGAACATGTCCTGATGG + Intergenic
904926189 1:34050072-34050094 TTATTTTCTAACTGTCCTGAAGG - Intronic
907708687 1:56855699-56855721 TTGCTTTAAAGCTATCCCGAAGG - Intronic
909076009 1:71051520-71051542 TTACTTTGATGCTTTACTTAAGG - Intergenic
909085734 1:71168326-71168348 TTATTTAGAAGCAGTTCTGAAGG - Intergenic
910652023 1:89579940-89579962 TTCCTTTGCAACTCTCCTGATGG + Intronic
913087518 1:115452580-115452602 CTACTTTAAAACTGTCCTCAAGG - Intergenic
914259277 1:145985322-145985344 AGAGTTTGAAGCTGTCCTGCGGG + Intergenic
921869513 1:220124395-220124417 TTAGTTTGTAGTTGTTCTGAGGG + Intronic
924101381 1:240606250-240606272 TAACTTTCAAGCTCCCCTGAGGG - Intronic
1063478721 10:6351561-6351583 TGACTTTGCAGCTGTGATGATGG + Intergenic
1066481675 10:35801821-35801843 TTATTTTGAAGCTCTCCTATAGG + Intergenic
1067445256 10:46338012-46338034 TTTCTTTGAACCTATCCAGATGG + Intergenic
1067592117 10:47522716-47522738 TTTCTTTGAACCTATCCAGATGG - Intronic
1067639234 10:48030788-48030810 TTTCTTTGAACCTATCCAGATGG - Intergenic
1067981125 10:51086148-51086170 TTACTTTGAAACTGTCCTCATGG + Intronic
1068042123 10:51838567-51838589 TTACTTGGAAAGTGTCCTGCAGG + Intronic
1068189930 10:53638102-53638124 GTATTTTGAAGCTTTCCTCATGG + Intergenic
1069906457 10:71735281-71735303 TTACTTAGAGGCTGTCCTGAGGG - Intronic
1073964785 10:108977051-108977073 TTACAGTGAAGCTGACCTAAGGG + Intergenic
1074196500 10:111191463-111191485 TTTCTTTGAAGCTATTGTGAGGG + Intergenic
1078680309 11:13469529-13469551 ATACTTTGTTGCTGTCCTTAGGG + Intergenic
1078861750 11:15254440-15254462 ATACTTTAAAGCTTTTCTGAAGG - Intergenic
1078962686 11:16296925-16296947 TTAATTTGTGGCTGTCCTGATGG - Intronic
1079857547 11:25624965-25624987 TTTCTCTGAAGGTTTCCTGAAGG + Intergenic
1081730130 11:45365948-45365970 TTACTTTTTAGTTGTCATGAAGG + Intergenic
1082825014 11:57571269-57571291 TTCCTTTGAAGATGCACTGAAGG - Intergenic
1083191970 11:61058575-61058597 TTACTTTGCTGAGGTCCTGAGGG - Intergenic
1084336726 11:68461828-68461850 TTACTTTGATTTTGTCCTCAAGG + Intronic
1085058249 11:73420886-73420908 TTACCTTCATGGTGTCCTGAGGG + Intronic
1086104958 11:83137623-83137645 TGACTCTGAAACTGTCCTCATGG - Intergenic
1092852455 12:12642657-12642679 TTAACTAGAAGCTGTCTTGAGGG - Exonic
1093459813 12:19397800-19397822 TTGCTCTGGAGCTGTGCTGAAGG + Intergenic
1094235117 12:28155421-28155443 TTACTTTGATGCTGTTTTTAAGG + Intronic
1098217706 12:68237506-68237528 TTATTTGGATGCTGCCCTGAAGG - Intergenic
1099401139 12:82204920-82204942 TTCCTTTGAGACTGTCCTTAGGG + Intergenic
1102353343 12:112211506-112211528 TTACCTTAGAGATGTCCTGAAGG + Intronic
1103082053 12:118032305-118032327 ATACTTTGCCGCTGTCCTTAAGG - Intronic
1103597831 12:122034950-122034972 TTACTTTGTACCTGGGCTGATGG + Intronic
1107604306 13:42042253-42042275 TTACTTTTAAACTTTCCTGTAGG + Intronic
1109894808 13:68671591-68671613 TTACTTTGCACATTTCCTGAAGG + Intergenic
1110360612 13:74620764-74620786 ATTCTTTGAAGCAGTCCTCATGG + Intergenic
1112591610 13:100768393-100768415 TTCCTTTGAATGTGTCCTGCTGG + Intergenic
1115798936 14:36970423-36970445 TTACTTTGAAGTTGGCCTAAAGG - Intronic
1118399544 14:65367076-65367098 GTACTTTGGAGCTGGCCAGAGGG + Intergenic
1119863207 14:77951993-77952015 TTATTCTGAAACTGTCCTCAGGG - Intergenic
1119990054 14:79186519-79186541 TTACATTGAAGTTGTCCCAAAGG + Intronic
1123019474 14:105390934-105390956 ATAGTTTGCAGCTGCCCTGAGGG + Intronic
1125144455 15:36450732-36450754 TGACGTTTAAGCTGTACTGAAGG - Intergenic
1126073241 15:44884158-44884180 ACACTTTAAAGCTGTCTTGAAGG + Intergenic
1127153296 15:56101529-56101551 ATATTTTGAAGCTGCCCAGAAGG + Exonic
1128410175 15:67388955-67388977 TAATTTTGAACCTGTCCTGCAGG - Exonic
1130860022 15:87877523-87877545 TCACTTTGAAACTGCCATGAAGG + Intronic
1134304252 16:13018185-13018207 CCACTGTGAAGCTGTGCTGATGG - Intronic
1134364944 16:13568503-13568525 TTCCTTTGATCCTGTTCTGATGG - Intergenic
1136619430 16:31418294-31418316 TGACTATGAAGGTGCCCTGAGGG - Exonic
1137956647 16:52838073-52838095 TCACAGTGAAGCTGTTCTGATGG + Intergenic
1138489158 16:57366153-57366175 TTATTTTCCAGCAGTCCTGAGGG - Exonic
1139065260 16:63305271-63305293 TTGTCTTGAAACTGTCCTGATGG + Intergenic
1139893560 16:70270195-70270217 TTACTTTGAAGCCATTCAGAAGG - Exonic
1140684020 16:77415670-77415692 TAACGTTGAAGCTTTCCTTAAGG - Intronic
1141565080 16:84895975-84895997 TAACTTTGAAATTTTCCTGAGGG + Intronic
1149078288 17:52623504-52623526 TGACCCTGAAGTTGTCCTGAAGG + Intergenic
1150504972 17:65689549-65689571 GTACATTGCAGGTGTCCTGAGGG - Intronic
1153744236 18:8161166-8161188 TAACTTGGAAGCTGTCATGCAGG + Intronic
1155630452 18:27886872-27886894 TAACTTTGAACCTGCTCTGACGG - Intergenic
1158131155 18:54153793-54153815 TTTCCTTGAAGCAGTCCTGCTGG - Exonic
1160375767 18:78410433-78410455 ATGCTTCGAGGCTGTCCTGAGGG - Intergenic
1166969733 19:46558193-46558215 TTCCTTTCATGCTTTCCTGAAGG + Intronic
925977181 2:9149635-9149657 TTTCTCTGGAGCTGACCTGATGG - Intergenic
926993785 2:18711249-18711271 TTACTTTGTAGCTTTCTTGATGG + Intergenic
928227863 2:29469127-29469149 ATACTATGAAGCTTTCCTAAAGG + Intronic
928297244 2:30094795-30094817 TTACTTTCAAACTGTCTAGATGG - Intergenic
929469630 2:42178679-42178701 TTATTTTTAAGCTGATCTGATGG + Intronic
931981119 2:67695067-67695089 TTGTTTTGAATCTGCCCTGAAGG + Intergenic
936874981 2:117177970-117177992 TTTCTATGAATTTGTCCTGAAGG - Intergenic
937979525 2:127606771-127606793 TTACTTTAAAGATGCCCTCAGGG + Intronic
938152245 2:128897424-128897446 TGGCTTTGAAGATGTGCTGAGGG - Intergenic
938603447 2:132867126-132867148 TTTTTTTGTAGCTGACCTGAAGG + Intronic
940249387 2:151657725-151657747 TTACTTTGAATCTGTCACCAAGG - Intronic
940806433 2:158192656-158192678 TTACTGTGAAGTTCTCATGAAGG - Intronic
942480350 2:176381090-176381112 TTACGTGGAAACTGTTCTGATGG + Intergenic
942693058 2:178607887-178607909 TTTCTTTGACGGTGTACTGACGG + Exonic
946210756 2:218145226-218145248 TGTCTCTGAAGCTGTCCTTAGGG - Intergenic
948025614 2:234773760-234773782 TTACTGTGAAGCTTCCATGAAGG - Intergenic
948478574 2:238236840-238236862 TTACTGTGAAGCTGACTTTAGGG + Intergenic
1170040581 20:12035572-12035594 TTGCTTTGAAGCAGTCCATATGG - Intergenic
1170385073 20:15807355-15807377 TTTCTTTGAAACTTCCCTGATGG - Intronic
1170495729 20:16923326-16923348 TTACTTGGCAGGTGTCCTAAAGG - Intergenic
1171415496 20:24977502-24977524 TCATTTGGAAGCTGTCCTGGGGG - Intronic
1173529242 20:43755964-43755986 TCACTTGTAAGCTGTCCTCAAGG - Intergenic
1175224532 20:57437335-57437357 TTGCTTTGAGGCTTTCCTCATGG + Intergenic
1176199624 20:63854520-63854542 CTGCTTTGAAGCTGCCCTGAGGG - Intergenic
1178267553 21:31158122-31158144 TTAGTTTGAAGCAGGCCTGTGGG + Intronic
1180015855 21:45083132-45083154 TTGCTCTGAATCTGTCCTGAGGG + Intronic
1180670600 22:17549481-17549503 TCACTTTCAAGCTGTGATGATGG + Exonic
949522562 3:4870015-4870037 TTACTTTGAAGCTGTCCTGATGG + Intronic
949587024 3:5451477-5451499 TAACATTGCTGCTGTCCTGATGG + Intergenic
949635238 3:5975040-5975062 ATACTTTGGTGCTGTCCTCATGG + Intergenic
952975051 3:38686753-38686775 TTACTTTGATACTGTTCTGGTGG + Intergenic
953854737 3:46492580-46492602 TGACTTCCCAGCTGTCCTGAGGG - Intergenic
956322794 3:68017170-68017192 TTACTTGGAAGCTTCCCGGATGG + Intronic
959595382 3:108123461-108123483 CTACTGGAAAGCTGTCCTGAAGG - Intergenic
961604619 3:128084363-128084385 TTACCTTGAAGCTGTGTTCAGGG - Intronic
966233748 3:177677318-177677340 TTTTTTGGAAGCTCTCCTGAAGG - Intergenic
966828928 3:183989222-183989244 TTACTTGGAAGTAGTCCGGATGG + Exonic
971669608 4:29540155-29540177 TTAGTCTGAAGCGGTCCAGATGG - Intergenic
972299507 4:37771665-37771687 TTCCTTTGGAGTTGTGCTGAAGG - Intergenic
975753708 4:77551283-77551305 TTCCTTTGAGGCTCTCTTGAAGG + Intronic
976637981 4:87307265-87307287 ATCCTTTGAAGCTGTCATGGTGG - Intronic
979452510 4:120889445-120889467 TTACTTCAAAGCTGCCTTGATGG + Intronic
979586852 4:122430048-122430070 TTGCTTTAAAGCTGTCCATATGG + Intergenic
979901683 4:126227906-126227928 TAACATTGTAGCTGGCCTGAAGG - Intergenic
980394082 4:132186104-132186126 CTTCTTTGAAGCTGCACTGAAGG + Intergenic
981482394 4:145252488-145252510 TAACTTTGAAGCTATCATGGTGG - Intergenic
984226806 4:177045085-177045107 TTACTTTGATTCTGTCTTCATGG - Intergenic
986629517 5:9756246-9756268 TTACTCTGATGCTTCCCTGAAGG - Intergenic
987729810 5:21754417-21754439 TTACTTGGAATGTGTCCTTAAGG + Intronic
988649118 5:33129076-33129098 TTTCTCTGCAGCTGTCCTCACGG + Intergenic
991203842 5:64026213-64026235 TTACTTTGAAGGTATCCTACTGG - Intergenic
992355241 5:75975061-75975083 TTACTTTGCAGTTGTCCTAAGGG + Intergenic
998789832 5:145754084-145754106 TTACCTTCAAGCTGTTCTGATGG - Intronic
999983489 5:156980517-156980539 TTAAGTTGAAGTAGTCCTGAGGG + Intergenic
1000029199 5:157387439-157387461 TTAATTTGAATCAGTCCTCAGGG - Intronic
1003262109 6:4527346-4527368 TTGATTTGAAGTTATCCTGAGGG - Intergenic
1003600770 6:7515018-7515040 TTAATATGAAAATGTCCTGAGGG - Intergenic
1004423660 6:15493324-15493346 TTATTTTGAAGCTCCCCTAAGGG + Intronic
1005099469 6:22154553-22154575 TTATTTTGAAACTGTGCTCAAGG + Intergenic
1005380287 6:25226917-25226939 TTACTTTCATGCTATTCTGATGG - Intergenic
1005669451 6:28090593-28090615 TGACTTTAAAAATGTCCTGACGG + Intergenic
1008446386 6:51597278-51597300 TTATTTTGCAGCTGTTATGAAGG - Intergenic
1009400959 6:63255128-63255150 TTACTTTCAAAGAGTCCTGAGGG - Intergenic
1011837086 6:91445742-91445764 TTACTATGAAATTGTCCTCAGGG + Intergenic
1015566968 6:134583317-134583339 TTACTATGAACTTGTCCTGAAGG + Intergenic
1022017701 7:26366332-26366354 TTTCTTTGAAGGTGTCCTAGAGG + Intronic
1023469959 7:40507041-40507063 TTCCTTTGAAGAGATCCTGATGG - Intronic
1029243190 7:99179223-99179245 TTACTTTGAAGATTTTCAGATGG + Intronic
1029507547 7:100971444-100971466 TTACCTCGAAGGTGTCCTGCAGG - Intronic
1031494690 7:122432121-122432143 TTACTTTGAATCAGTCTTGGAGG + Intronic
1034847030 7:154455924-154455946 TTAATTTGAAGCTGACCAGGAGG - Intronic
1037688470 8:21163543-21163565 CCACTTTGAAGCTGTCGAGATGG + Intergenic
1040682513 8:49830292-49830314 TAACTTTGAAGCTGTTCTTTAGG + Intergenic
1041429273 8:57760540-57760562 TGACTTAGAAGAGGTCCTGAAGG + Intergenic
1044324643 8:90846096-90846118 TTACATTAAAGCTGGCATGAAGG - Intronic
1045514615 8:102847395-102847417 TTTCTTTGATGCTCTCTTGAAGG + Intronic
1046126450 8:109914804-109914826 TTACTGTTAAGCTGAACTGAAGG + Intergenic
1046604692 8:116358101-116358123 TTACTTTAAATCTGTCAAGAGGG - Intergenic
1055803421 9:80066383-80066405 TTACTTTTGAGCTATTCTGAGGG + Intergenic
1056479995 9:86992741-86992763 TGCATTTGAAGCTGTCCTGTGGG - Intergenic
1059141572 9:111857871-111857893 TTACCTTGAAGGTCTACTGACGG - Intergenic
1187711696 X:22060881-22060903 TTACTTTGCAGTTGTTCAGAAGG + Intronic
1197064178 X:122219655-122219677 CTACTTTGAAGCTTTCATGAAGG + Intergenic
1198818250 X:140616153-140616175 TTACTTTGAAGCACTCTTGTTGG + Intergenic
1200237296 X:154473803-154473825 CTACCTTGAATCTGTCTTGAAGG - Intergenic
1201391841 Y:13506179-13506201 TTACTTTTACTCTGTCCTGGAGG - Intergenic