ID: 949539142

View in Genome Browser
Species Human (GRCh38)
Location 3:5018617-5018639
Sequence GTGTTCTAGTAGAGGGGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949539138_949539142 -5 Left 949539138 3:5018599-5018621 CCTGATTTCATGCAGCTCGTGTT No data
Right 949539142 3:5018617-5018639 GTGTTCTAGTAGAGGGGTGAAGG No data
949539137_949539142 -4 Left 949539137 3:5018598-5018620 CCCTGATTTCATGCAGCTCGTGT No data
Right 949539142 3:5018617-5018639 GTGTTCTAGTAGAGGGGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949539142 Original CRISPR GTGTTCTAGTAGAGGGGTGA AGG Intergenic
No off target data available for this crispr