ID: 949539142 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:5018617-5018639 |
Sequence | GTGTTCTAGTAGAGGGGTGA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
949539138_949539142 | -5 | Left | 949539138 | 3:5018599-5018621 | CCTGATTTCATGCAGCTCGTGTT | No data | ||
Right | 949539142 | 3:5018617-5018639 | GTGTTCTAGTAGAGGGGTGAAGG | No data | ||||
949539137_949539142 | -4 | Left | 949539137 | 3:5018598-5018620 | CCCTGATTTCATGCAGCTCGTGT | No data | ||
Right | 949539142 | 3:5018617-5018639 | GTGTTCTAGTAGAGGGGTGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
949539142 | Original CRISPR | GTGTTCTAGTAGAGGGGTGA AGG | Intergenic | ||
No off target data available for this crispr |