ID: 949543689

View in Genome Browser
Species Human (GRCh38)
Location 3:5054164-5054186
Sequence GGCCCCATGACAGGTAGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949543689_949543697 11 Left 949543689 3:5054164-5054186 CCTGCCCTACCTGTCATGGGGCC No data
Right 949543697 3:5054198-5054220 TGTCAATGGAGTGCTCCCATGGG No data
949543689_949543694 -3 Left 949543689 3:5054164-5054186 CCTGCCCTACCTGTCATGGGGCC No data
Right 949543694 3:5054184-5054206 GCCGCAGGTTTTCATGTCAATGG No data
949543689_949543696 10 Left 949543689 3:5054164-5054186 CCTGCCCTACCTGTCATGGGGCC No data
Right 949543696 3:5054197-5054219 ATGTCAATGGAGTGCTCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949543689 Original CRISPR GGCCCCATGACAGGTAGGGC AGG (reversed) Intergenic
No off target data available for this crispr