ID: 949552438

View in Genome Browser
Species Human (GRCh38)
Location 3:5122383-5122405
Sequence CACACGAGCGGGCCTCCGCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 48}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949552438_949552446 29 Left 949552438 3:5122383-5122405 CCGGGCGGAGGCCCGCTCGTGTG 0: 1
1: 0
2: 0
3: 2
4: 48
Right 949552446 3:5122435-5122457 CTCCCGTCCGTTCTCGCTCCCGG 0: 1
1: 0
2: 1
3: 3
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949552438 Original CRISPR CACACGAGCGGGCCTCCGCC CGG (reversed) Exonic
901068296 1:6505050-6505072 CCCAGGAGCTGGCCTCCCCCAGG - Intronic
901088373 1:6625551-6625573 CAGACTAGCGGGCCGCGGCCGGG + Intronic
902759205 1:18570028-18570050 CCCAGGAGAGGGCCTGCGCCTGG - Intergenic
913457579 1:119049192-119049214 CACACCAGCGGGCCACTGACGGG + Intronic
1074169409 10:110918697-110918719 CACGGGGGCGGGCCGCCGCCAGG + Intronic
1077896399 11:6456723-6456745 CACGGGAGAGGGCCTGCGCCAGG - Exonic
1078930019 11:15905625-15905647 CACAGGCGCTGGCCACCGCCTGG + Intergenic
1081929534 11:46859186-46859208 CTCACGGGGGGGCCTCCTCCGGG - Exonic
1092262625 12:6960595-6960617 CACACGTGTGGGCCTCTGCTAGG + Intronic
1106415698 13:29544013-29544035 CACAGCATCGGGCCTCAGCCAGG + Intronic
1119362944 14:74067071-74067093 CACAGGTGCGGGCCACCACCTGG - Intronic
1122544388 14:102514246-102514268 CACTCCAGCCGGCCTCCTCCAGG - Intergenic
1128704451 15:69828425-69828447 CACACTACAGGGCCTCTGCCAGG - Intergenic
1132286646 15:100668427-100668449 CAGAGGAGGGGGCTTCCGCCTGG + Intergenic
1136025954 16:27469286-27469308 CTCACCAGCGGGCCTGAGCCGGG + Exonic
1141710333 16:85695284-85695306 CCCACGACCAGGCCTCCTCCTGG + Intronic
1142033588 16:87850497-87850519 CACCAGAGCGTGCATCCGCCGGG + Intronic
1147285604 17:39401128-39401150 CCCACCAGCGGGCCCCCGCGGGG - Intronic
1148534746 17:48430045-48430067 CACTGGAGGGGGCCTGCGCCAGG + Intronic
1155300767 18:24426861-24426883 CAGCCGAGGGGCCCTCCGCCTGG + Intronic
1160100440 18:75915961-75915983 CAGAGGAGCGGGCCTGGGCCGGG - Intergenic
1160873261 19:1286400-1286422 CCCACGCGCGCGCCGCCGCCGGG + Intronic
1161380682 19:3963613-3963635 CAGCCGAGGGGGCCCCCGCCAGG + Intronic
1161707234 19:5827845-5827867 CGCACGCGCGCGCCGCCGCCGGG - Exonic
1161718735 19:5891954-5891976 CACACAAGAGGGCCCCCGTCTGG - Exonic
1163575915 19:18110600-18110622 CACACGAAGGGGCGGCCGCCAGG + Intronic
1166688916 19:44811229-44811251 CAGACAAGCGCACCTCCGCCTGG - Exonic
925300193 2:2806316-2806338 CACACGGCCGGGCCACCCCCCGG + Intergenic
926087956 2:10032041-10032063 CACCCGAGGGGGCCTCACCCAGG + Intergenic
934738525 2:96702705-96702727 CACACGTGCGCTCCGCCGCCAGG - Intergenic
942145005 2:173018253-173018275 CACACAGGAGGGCTTCCGCCTGG - Intronic
945251247 2:207768171-207768193 CACACGAACGGGCCCCCAGCGGG + Exonic
946240834 2:218354539-218354561 TAGACCTGCGGGCCTCCGCCTGG - Intergenic
1179265568 21:39799400-39799422 CACACTCTTGGGCCTCCGCCAGG + Intronic
1180085243 21:45505301-45505323 CACACGAGGCGGCCTCTGCCCGG - Intronic
949552438 3:5122383-5122405 CACACGAGCGGGCCTCCGCCCGG - Exonic
949987870 3:9553863-9553885 CTCGGGAGCGCGCCTCCGCCGGG - Intergenic
981504306 4:145482451-145482473 CACGCGAACGGGCCTCGGCCCGG - Intronic
986328613 5:6701243-6701265 CACAAGAGAGGGCCTCCTCGAGG + Intergenic
1000052662 5:157575843-157575865 CAGCCCCGCGGGCCTCCGCCAGG + Intergenic
1018085923 6:160300952-160300974 CACACCATCGGGGCTCAGCCAGG + Intergenic
1030759410 7:113332045-113332067 CAGACGAGCGGGTTTCCCCCCGG + Intergenic
1035592342 8:825406-825428 CACAGAAGCTGGCCTCTGCCCGG + Intergenic
1037936706 8:22919858-22919880 CACACCAGCTGGTCTCCACCAGG + Intronic
1042102154 8:65285084-65285106 CAGAGGAGGGGGCCCCCGCCTGG - Intergenic
1053008173 9:34618097-34618119 CACATGAGCAGGGCTCCACCAGG + Intronic
1056765270 9:89441256-89441278 CACACGCGCAGGACTCGGCCGGG + Intronic
1061128121 9:128689476-128689498 CACACGCGCGGGCGCCCGCTCGG - Intronic
1062095915 9:134703305-134703327 CACAGGAGCCGTCCTCAGCCAGG + Intronic
1186200014 X:7147783-7147805 CCCACGCGCGGGCCGCCGACCGG + Intronic
1189377031 X:40474372-40474394 AACACAAGCCAGCCTCCGCCAGG - Intergenic