ID: 949552446

View in Genome Browser
Species Human (GRCh38)
Location 3:5122435-5122457
Sequence CTCCCGTCCGTTCTCGCTCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 60}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949552440_949552446 18 Left 949552440 3:5122394-5122416 CCCGCTCGTGTGGAAGTCGTCGA 0: 1
1: 0
2: 1
3: 0
4: 9
Right 949552446 3:5122435-5122457 CTCCCGTCCGTTCTCGCTCCCGG 0: 1
1: 0
2: 1
3: 3
4: 60
949552441_949552446 17 Left 949552441 3:5122395-5122417 CCGCTCGTGTGGAAGTCGTCGAC 0: 1
1: 0
2: 0
3: 0
4: 11
Right 949552446 3:5122435-5122457 CTCCCGTCCGTTCTCGCTCCCGG 0: 1
1: 0
2: 1
3: 3
4: 60
949552443_949552446 -10 Left 949552443 3:5122422-5122444 CCGCTCGTCCGTCCTCCCGTCCG 0: 1
1: 0
2: 1
3: 11
4: 208
Right 949552446 3:5122435-5122457 CTCCCGTCCGTTCTCGCTCCCGG 0: 1
1: 0
2: 1
3: 3
4: 60
949552442_949552446 -7 Left 949552442 3:5122419-5122441 CCGCCGCTCGTCCGTCCTCCCGT 0: 1
1: 0
2: 0
3: 4
4: 113
Right 949552446 3:5122435-5122457 CTCCCGTCCGTTCTCGCTCCCGG 0: 1
1: 0
2: 1
3: 3
4: 60
949552438_949552446 29 Left 949552438 3:5122383-5122405 CCGGGCGGAGGCCCGCTCGTGTG 0: 1
1: 0
2: 0
3: 2
4: 48
Right 949552446 3:5122435-5122457 CTCCCGTCCGTTCTCGCTCCCGG 0: 1
1: 0
2: 1
3: 3
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949552446 Original CRISPR CTCCCGTCCGTTCTCGCTCC CGG Exonic
901921435 1:12540385-12540407 CTCCCGGCCCTGCTGGCTCCTGG - Intergenic
902383540 1:16063948-16063970 CTCCCGTCCTCTTTTGCTCCTGG + Intronic
904110336 1:28121330-28121352 CTCCCGTCCGTCCTCGCTGCCGG - Intergenic
907523182 1:55038369-55038391 CTCCCATCTATTCTTGCTCCAGG + Intergenic
1073044998 10:100631899-100631921 CTCCCGCCCGTGCCCGCTGCGGG + Intergenic
1074233940 10:111565909-111565931 CTCCCTTGCTTTCTGGCTCCTGG - Intergenic
1077403165 11:2368946-2368968 CTCCCCTTCGTTCTTGCTCTGGG - Intergenic
1091207708 11:133832905-133832927 CGCCCGTCCCCGCTCGCTCCCGG - Intergenic
1091393929 12:142195-142217 CTCCCTTTCATCCTCGCTCCTGG + Intronic
1094219296 12:27975293-27975315 CTCCCCTCCCCTCTCCCTCCAGG + Intergenic
1096692275 12:53328595-53328617 CTCCCAGCCGCTCTAGCTCCTGG + Exonic
1102961021 12:117093296-117093318 CTCCACTGCGTTCTCGCCCCTGG - Intronic
1105546291 13:21353086-21353108 CTCCTGTAAGTTCTCTCTCCTGG + Intergenic
1118001243 14:61525900-61525922 CCCCCGGCCGTGCTCTCTCCTGG + Intronic
1125937322 15:43648599-43648621 CTCTCCTCCATTCTCGCTTCTGG + Intronic
1125950225 15:43746018-43746040 CTCTCCTCCATTCTCGCTTCTGG + Intergenic
1129463744 15:75712591-75712613 CTCCTGTCCCTTTTCCCTCCCGG + Intronic
1131937981 15:97528239-97528261 CTCCCATCCTTTCCTGCTCCAGG - Intergenic
1132803789 16:1766522-1766544 CTCTGGCCCGTTCTCGCTGCAGG - Exonic
1132951098 16:2562902-2562924 CTCCTGCCCGTTCTCCCGCCTGG - Intronic
1132963251 16:2637268-2637290 CTCCTGCCCGTTCTCCCGCCTGG + Intergenic
1136076265 16:27819503-27819525 CTCACGTCTGTTCTCCCTCCTGG - Intronic
1145214472 17:21042060-21042082 CTCCCGTCCAAGGTCGCTCCTGG + Intronic
1152917927 17:83051650-83051672 CTCCAGTCCTCTCTCGCTCCGGG - Intronic
1158593169 18:58794397-58794419 CTCCCGTCCTTTATCGCCACTGG - Intergenic
1161001468 19:1913167-1913189 CTCCGGACCCTTCCCGCTCCCGG + Exonic
1161312052 19:3600211-3600233 CACCCGGCCCTTCTCGCGCCCGG - Exonic
1162324944 19:9993433-9993455 CTCCCCTCTGTTCCCTCTCCAGG - Exonic
1163329424 19:16627491-16627513 CTCCCTCCCCTTCCCGCTCCGGG + Intronic
1166338267 19:42121983-42122005 CTCCCGCCCCTTCTCACTCTTGG - Intronic
1167103982 19:47419809-47419831 CTCCCGTCCTTTCTCTCCTCTGG + Intergenic
934882456 2:97995762-97995784 CTCGCAACCGTTGTCGCTCCCGG - Exonic
935775088 2:106466140-106466162 TTCCCGACGGTGCTCGCTCCTGG - Intronic
935904981 2:107829756-107829778 TTCCCGACGGTGCTCGCTCCTGG + Intronic
935960858 2:108424227-108424249 ATCCCATCCATTCTCGCTCGAGG - Intergenic
935991141 2:108719925-108719947 TTCCCGACGGTGCTCGCTCCTGG + Intronic
936126758 2:109794828-109794850 TTCCCGACGGTGCTCGCTCCTGG + Intronic
936217939 2:110576658-110576680 TTCCCGACGGTGCTCGCTCCTGG - Intronic
944989552 2:205220287-205220309 CTTCCGCCTGTTCTCTCTCCAGG + Intronic
945661460 2:212690853-212690875 CTCCCTTGCTTTCTGGCTCCTGG + Intergenic
948918576 2:241050991-241051013 GTCCCTTCCGTACTCCCTCCGGG - Intronic
1171779632 20:29407943-29407965 CTCCCTTCCGCCCACGCTCCAGG - Intergenic
949552446 3:5122435-5122457 CTCCCGTCCGTTCTCGCTCCCGG + Exonic
953668489 3:44943248-44943270 GTCCCGGCAGTTCTGGCTCCAGG - Intronic
957085502 3:75672693-75672715 CTCCCTTCCGCCCACGCTCCAGG + Intergenic
980739696 4:136933133-136933155 CTCCCCTCCCTTCCTGCTCCTGG - Intergenic
980944412 4:139304846-139304868 CTCCCATCCCCTCTCGCTGCAGG + Intronic
985444507 4:190014823-190014845 CTCCCTTCCGCCCACGCTCCAGG - Intergenic
986462722 5:7989644-7989666 CTCCCGTAGGTGCTCTCTCCTGG - Intergenic
994433179 5:99695069-99695091 CTCACGTCTGTGCTCCCTCCTGG - Intergenic
997452026 5:133991417-133991439 CTCCCTTCCATCCTGGCTCCAGG + Intronic
999375004 5:151080844-151080866 CTCCCCTCCATCCCCGCTCCGGG + Intronic
1002073605 5:176695319-176695341 CTCCCCTCCCTTCTGGCTCATGG - Intergenic
1007105877 6:39282530-39282552 TTCCCGTCTGTTCTCTCCCCAGG - Intergenic
1018808669 6:167281383-167281405 CTCCAATCCATTCTCACTCCTGG - Intronic
1019619169 7:1981339-1981361 CCGCAGTCCGTTCTGGCTCCTGG - Intronic
1020137135 7:5593839-5593861 CTCCCGCCCTTTCTCGCTCGCGG + Intronic
1021526172 7:21591462-21591484 CTCTCGTCTGTGCTCTCTCCTGG - Exonic
1024373954 7:48617520-48617542 CTCTCTTCCGTTCTCCCTCTGGG - Intronic
1031081105 7:117257735-117257757 CTCCAGTCCATTCTCACTCAGGG + Intergenic
1048484004 8:134831493-134831515 CTCCCGGCCTCTCTCACTCCCGG + Intergenic
1049539793 8:143203140-143203162 CTCCCTTCCTGTCTTGCTCCAGG + Intergenic
1052807509 9:33025675-33025697 TCCCCGTCCGTGCTCGCTCGGGG + Intronic
1060104618 9:120865959-120865981 CTCCCCTCCCTCCTCCCTCCTGG - Intronic
1061942314 9:133890368-133890390 CTGCAGTCCGTGCTCACTCCTGG - Intronic