ID: 949555818

View in Genome Browser
Species Human (GRCh38)
Location 3:5151722-5151744
Sequence GATCCTATCTCCAAGGGGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 86}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949555818_949555827 -1 Left 949555818 3:5151722-5151744 CCCCCCCCCTTGGAGATAGGATC 0: 1
1: 0
2: 0
3: 9
4: 86
Right 949555827 3:5151744-5151766 CTTGCTGTCTTCCTCCAGGCTGG 0: 1
1: 0
2: 4
3: 104
4: 977
949555818_949555832 22 Left 949555818 3:5151722-5151744 CCCCCCCCCTTGGAGATAGGATC 0: 1
1: 0
2: 0
3: 9
4: 86
Right 949555832 3:5151767-5151789 GCTGCAGTGGTGTGTGATCACGG 0: 1
1: 0
2: 18
3: 116
4: 497
949555818_949555828 0 Left 949555818 3:5151722-5151744 CCCCCCCCCTTGGAGATAGGATC 0: 1
1: 0
2: 0
3: 9
4: 86
Right 949555828 3:5151745-5151767 TTGCTGTCTTCCTCCAGGCTGGG 0: 1
1: 0
2: 3
3: 46
4: 377
949555818_949555826 -5 Left 949555818 3:5151722-5151744 CCCCCCCCCTTGGAGATAGGATC 0: 1
1: 0
2: 0
3: 9
4: 86
Right 949555826 3:5151740-5151762 GGATCTTGCTGTCTTCCTCCAGG 0: 1
1: 0
2: 2
3: 30
4: 301
949555818_949555829 9 Left 949555818 3:5151722-5151744 CCCCCCCCCTTGGAGATAGGATC 0: 1
1: 0
2: 0
3: 9
4: 86
Right 949555829 3:5151754-5151776 TCCTCCAGGCTGGGCTGCAGTGG 0: 1
1: 6
2: 612
3: 17334
4: 192107
949555818_949555833 26 Left 949555818 3:5151722-5151744 CCCCCCCCCTTGGAGATAGGATC 0: 1
1: 0
2: 0
3: 9
4: 86
Right 949555833 3:5151771-5151793 CAGTGGTGTGTGATCACGGCTGG 0: 1
1: 0
2: 0
3: 69
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949555818 Original CRISPR GATCCTATCTCCAAGGGGGG GGG (reversed) Intronic
902776374 1:18677244-18677266 GATCTTGTTTCTAAGGGGGGCGG + Intronic
912806183 1:112758768-112758790 GAGCCTATGTCCATGGGGAGAGG - Intergenic
914438711 1:147682251-147682273 GAGCCTATATCCATTGGGGGTGG - Intergenic
915616638 1:157044427-157044449 GATTCTATCTTCAAGTTGGGAGG - Exonic
920286228 1:204881850-204881872 GATCAGATATCCAAGGTGGGGGG - Intronic
921335674 1:214083421-214083443 GATCTTATTTGCAAAGGGGGTGG - Intergenic
922091820 1:222402832-222402854 GATGCTATCTCTGAGTGGGGAGG - Intergenic
923081596 1:230661968-230661990 CACCCTATCTCCAAGGGTGGGGG - Intronic
924561638 1:245161387-245161409 AATCCTATCTGCAATGGGTGTGG - Intronic
1063745667 10:8877747-8877769 TGTCCTGTCTCCCAGGGGGGTGG - Intergenic
1067464696 10:46489129-46489151 GATGCTCTCTCTAAGAGGGGAGG - Intergenic
1067622498 10:47895524-47895546 GATGCTCTCTCTAAGAGGGGAGG + Intergenic
1069838512 10:71324790-71324812 GATCAGATCTCAAAGGTGGGGGG + Intronic
1070736007 10:78864101-78864123 GATGCTATCTACTAGGGAGGTGG + Intergenic
1071115513 10:82214471-82214493 GACCTTGTCTCCAAGGGCGGGGG - Intronic
1077487809 11:2847106-2847128 GATGCTTTCTGCAAGGGGGTGGG - Intronic
1083436945 11:62649153-62649175 GATGCTATCTCCGTGGCGGGAGG + Exonic
1088152931 11:106768901-106768923 GTTCCCATCTCAAAGTGGGGAGG - Intronic
1093781457 12:23142056-23142078 AATCCTGTCTTCAAGGGGGATGG + Intergenic
1099448056 12:82775439-82775461 GACCCTGTCTCCAGGGGGGCGGG + Intronic
1105978438 13:25494326-25494348 GATGTAATCTCCAAGGTGGGCGG + Intronic
1106763960 13:32895217-32895239 GATCCTCTCTCCAAAGAGCGGGG - Intergenic
1107838210 13:44429198-44429220 ACTCCTAACTCCAAGGGGGCGGG + Intergenic
1110228991 13:73148785-73148807 GATCCTATCACCCAGGGAGTGGG - Intergenic
1115064730 14:29244254-29244276 GATCCCATCTCTGAGGTGGGTGG + Intergenic
1118087964 14:62440913-62440935 TATCCTATCTCCTTGGGGAGTGG - Intergenic
1119196143 14:72718001-72718023 GATCCTACCTCCAAGGGGTTTGG + Intronic
1127196973 15:56597739-56597761 TATCCTAGCTCAAAGGGGGTTGG + Intergenic
1129141766 15:73605087-73605109 GACCCTGTCTCAAGGGGGGGGGG + Intronic
1129208809 15:74053632-74053654 GTTCCTTTCTCCAGGGGGGTTGG - Intergenic
1133495834 16:6316175-6316197 CATCCTATACCCAAGGGGGTTGG - Intronic
1135487739 16:22880641-22880663 GAGCCCATCTCCATGGGGGGAGG - Intronic
1135806993 16:25551962-25551984 GACCCTGTCTCCAAAGTGGGGGG - Intergenic
1135945161 16:26858842-26858864 GATCCTGTTTCCAAGCTGGGGGG + Intergenic
1140078397 16:71723174-71723196 GATTCTCTCTCCAAGCTGGGCGG + Intronic
1147915255 17:43881865-43881887 GAGCCCTTCTCCAAGGGGAGAGG - Intronic
1148745343 17:49914914-49914936 GAACCTATCTCCTAGGGCTGTGG - Intergenic
1149457958 17:56804071-56804093 ATTCCTTTCTCCAAGTGGGGGGG + Intronic
1150001897 17:61445648-61445670 GACCCTATCTCCACTGGGCGCGG - Intergenic
1151277755 17:73048685-73048707 GAGCTTATCTCCTAGGGTGGTGG + Intronic
1158151049 18:54370890-54370912 GATGCTATCTCCCAGGGTGTAGG + Intronic
1158522522 18:58183568-58183590 AAAGCTATCTCCAAGGAGGGGGG - Intronic
1163237335 19:16037361-16037383 GAGCCTCTCTGCAAGGGGGATGG - Intergenic
925577287 2:5373457-5373479 GCTCCTCTCTCCCAGGGGGCCGG + Intergenic
925772087 2:7292345-7292367 GAGCCTGTCTTCAAGGGTGGTGG + Intergenic
927722926 2:25398371-25398393 GATCCTAACGCCAAGGGCTGGGG - Intronic
945121940 2:206466800-206466822 GATGCCAGCTCCAAGGGGGATGG + Intronic
948751851 2:240137683-240137705 GATCCAATATCCAGGGTGGGGGG - Intergenic
1168981237 20:2005750-2005772 GATCATGTCTACAATGGGGGTGG - Intergenic
1169438549 20:5614688-5614710 GATCCTAGCTACCAGGGAGGTGG - Intergenic
1174199907 20:48799874-48799896 GATCCTATCTGGATGGGTGGAGG - Intronic
1174269484 20:49356871-49356893 GTTCCTCTCCCCAAGGAGGGGGG + Intergenic
1175194359 20:57232201-57232223 GTTACTATCTCCAGGGGGAGGGG - Intronic
1175396822 20:58670361-58670383 AAGCCTATCTCCAATGGGGGTGG - Intronic
1176166357 20:63676075-63676097 GACCCCATCTCCAAAGGGGTGGG - Intronic
1181087871 22:20451238-20451260 GATCAAATCTCCCAGGGTGGTGG - Intronic
1181801769 22:25352346-25352368 GCTCCTAACTCCAAGGTGGATGG - Intronic
1185250655 22:49799925-49799947 GACCCTACCTCAAAGGGGAGAGG + Intronic
1185376316 22:50484110-50484132 GTTCCTACCTCCAAGGGGGAGGG + Exonic
949555818 3:5151722-5151744 GATCCTATCTCCAAGGGGGGGGG - Intronic
952864523 3:37844370-37844392 GATCCTATGGCCGAGCGGGGTGG + Intergenic
953169530 3:40494849-40494871 GATCCTATGGCCCAGGGGGCTGG + Intergenic
953829158 3:46280603-46280625 GACCCTGTCTCAAAGGGGCGGGG - Intergenic
954424272 3:50435074-50435096 CAGCCTTCCTCCAAGGGGGGTGG + Intronic
959557119 3:107733499-107733521 GACCCTGTCTCAAGGGGGGGTGG - Intronic
960610042 3:119547332-119547354 TCTCCTTTCTCCAAGGGGGTGGG + Intronic
961600769 3:128059964-128059986 GATACTACCTCCAAGGGGCTCGG - Intronic
962750678 3:138432933-138432955 GATCCTGTCTCCAAGGGGTTTGG + Intergenic
963234267 3:142940926-142940948 GATACTATCTCTAAGGTGGAAGG - Intergenic
966817410 3:183900534-183900556 CATCCTATCCTCAAGGGGAGGGG - Intergenic
970907494 4:21233291-21233313 GATTGTATGTCCAAGGGGGGAGG + Intronic
974594056 4:63994636-63994658 GATGCTATGTCCCATGGGGGTGG + Intergenic
975807709 4:78130090-78130112 GATGCTATCTTTAAGGGTGGGGG - Intronic
977316135 4:95450218-95450240 GATCCCATCTTCAAGGGGGTTGG - Intronic
982234989 4:153243819-153243841 GATCCTGTCTCAAGGGGGGGGGG - Intronic
982580354 4:157169988-157170010 GATCCTATTTCCAAGTAGAGCGG - Intronic
987074854 5:14371757-14371779 AGTCCTAGCTCCTAGGGGGGCGG - Intronic
999696039 5:154189929-154189951 CATTCTAACTCCAAGGGGGTTGG + Intronic
1007368332 6:41409682-41409704 TTTCCTATCTCTAAGGGAGGAGG - Intergenic
1007421352 6:41721720-41721742 GTTCCTATCTCCTAGGGTGATGG - Intronic
1008788925 6:55204792-55204814 GACCCTATCTCCAAAGGGAAGGG - Intronic
1013766367 6:113578648-113578670 GTTTCTAGCTCCAAAGGGGGGGG - Intergenic
1017697714 6:157034951-157034973 GATTCTATCTCCAGGAGGGCTGG - Intronic
1021317852 7:19172107-19172129 GACCCTATCTACAAGGGAAGTGG - Intergenic
1036792975 8:11735500-11735522 GATCCCATCTCCAGGGGCAGAGG - Intronic
1046808984 8:118512078-118512100 GATCCTATTTCCAAATGAGGAGG - Intronic
1048458596 8:134601340-134601362 GTTCCTATCTACAATGGAGGAGG + Intronic
1048868239 8:138776448-138776470 GACCCTATCCCCGAGGGAGGAGG - Intronic
1050713069 9:8487858-8487880 GACCTTATCTCTACGGGGGGAGG + Intronic
1060563396 9:124567259-124567281 GATCAGAACTCCAAGGGGTGGGG + Intronic
1061940717 9:133882430-133882452 GATCCTATTTCCAAAGAAGGTGG - Intronic
1189628840 X:42930061-42930083 GGTCCTATTTCTAAGGGGTGTGG + Intergenic
1192780889 X:74292945-74292967 GGTCCCAACTCCAAGGGAGGGGG + Intergenic
1198567969 X:137924596-137924618 GGTCCGATGTCCAATGGGGGTGG + Intergenic
1199172477 X:144747044-144747066 GATGCTATGTCCCATGGGGGTGG - Intergenic
1199940329 X:152619923-152619945 GATCCTATCTACAAAGAAGGTGG - Intergenic