ID: 949559713

View in Genome Browser
Species Human (GRCh38)
Location 3:5189682-5189704
Sequence CACTTTAACCACAGAGGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 28771
Summary {0: 1, 1: 2, 2: 154, 3: 2045, 4: 26569}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949559713_949559717 8 Left 949559713 3:5189682-5189704 CCTCCGCCTCTGTGGTTAAAGTG 0: 1
1: 2
2: 154
3: 2045
4: 26569
Right 949559717 3:5189713-5189735 GCCTCAGCCTCCCGAGTAGCTGG 0: 94911
1: 257638
2: 218586
3: 135882
4: 139272
949559713_949559719 9 Left 949559713 3:5189682-5189704 CCTCCGCCTCTGTGGTTAAAGTG 0: 1
1: 2
2: 154
3: 2045
4: 26569
Right 949559719 3:5189714-5189736 CCTCAGCCTCCCGAGTAGCTGGG 0: 99957
1: 284367
2: 226920
3: 125442
4: 164576

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949559713 Original CRISPR CACTTTAACCACAGAGGCGG AGG (reversed) Intronic
Too many off-targets to display for this crispr