ID: 949559713 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:5189682-5189704 |
| Sequence | CACTTTAACCACAGAGGCGG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 28771 | |||
| Summary | {0: 1, 1: 2, 2: 154, 3: 2045, 4: 26569} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 949559713_949559717 | 8 | Left | 949559713 | 3:5189682-5189704 | CCTCCGCCTCTGTGGTTAAAGTG | 0: 1 1: 2 2: 154 3: 2045 4: 26569 |
||
| Right | 949559717 | 3:5189713-5189735 | GCCTCAGCCTCCCGAGTAGCTGG | 0: 94911 1: 257638 2: 218586 3: 135882 4: 139272 |
||||
| 949559713_949559719 | 9 | Left | 949559713 | 3:5189682-5189704 | CCTCCGCCTCTGTGGTTAAAGTG | 0: 1 1: 2 2: 154 3: 2045 4: 26569 |
||
| Right | 949559719 | 3:5189714-5189736 | CCTCAGCCTCCCGAGTAGCTGGG | 0: 99957 1: 284367 2: 226920 3: 125442 4: 164576 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 949559713 | Original CRISPR | CACTTTAACCACAGAGGCGG AGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||