ID: 949562764

View in Genome Browser
Species Human (GRCh38)
Location 3:5218047-5218069
Sequence TTCCAGGAGCATGAGGAGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 706
Summary {0: 1, 1: 0, 2: 7, 3: 72, 4: 626}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949562764_949562772 22 Left 949562764 3:5218047-5218069 CCTTCCTCCTCATGCTCCTGGAA 0: 1
1: 0
2: 7
3: 72
4: 626
Right 949562772 3:5218092-5218114 TGCAAACTACACAATGCTGCAGG 0: 1
1: 0
2: 0
3: 15
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949562764 Original CRISPR TTCCAGGAGCATGAGGAGGA AGG (reversed) Exonic
900133645 1:1103683-1103705 TTCCAGGAGCAGGCAGGGGAAGG - Intronic
900394305 1:2446868-2446890 CTGCAGGGGCAGGAGGAGGAAGG - Intronic
900486041 1:2923282-2923304 GACCAAGAGCGTGAGGAGGAGGG - Intergenic
900547125 1:3235434-3235456 TTCCGGAAGCAGAAGGAGGAAGG + Intronic
900826213 1:4929323-4929345 TTGCAGGGGGATGAGGTGGAGGG - Intergenic
900858261 1:5203706-5203728 TGGCAGGAGCAGGAGGAAGAGGG + Intergenic
901034361 1:6327385-6327407 CGGCAGGAGCAGGAGGAGGAGGG - Exonic
901240389 1:7689669-7689691 TTCCAGAAGAATGAGGAGATTGG - Intronic
901281628 1:8040817-8040839 TCCCAGGAGCTTGAGGAATAAGG + Intergenic
901391374 1:8948498-8948520 TTCCTGCAGCATGGGGAGGTGGG + Intronic
901536068 1:9883670-9883692 TTCCAGGAGGACCATGAGGAGGG - Intronic
901647186 1:10723072-10723094 CGCCAGGAGCCAGAGGAGGAAGG + Intronic
902095416 1:13940167-13940189 TTCCAAAAGAATGAAGAGGAGGG - Intergenic
902572616 1:17356402-17356424 TTCCAGGAGCAGCAGAATGAGGG + Exonic
902573834 1:17364201-17364223 TTCCAAGAAGAGGAGGAGGAGGG + Intergenic
902624421 1:17668339-17668361 GTCCAGGAGCATGGGACGGATGG + Intronic
902787658 1:18743543-18743565 ATCCAGAAGCAAGAGGAAGATGG - Intronic
903413812 1:23168227-23168249 CTGCAGCAGCAGGAGGAGGAGGG - Intronic
903603532 1:24558635-24558657 TCCCAGGAGCAACAGGATGAGGG - Intronic
903947718 1:26974047-26974069 TTCAACGTGCATGAGCAGGAGGG + Intergenic
904145092 1:28384197-28384219 TTCCAAAAGAATGAAGAGGAGGG - Intronic
904577573 1:31514857-31514879 CTCCAGGGTCCTGAGGAGGATGG + Intergenic
906036940 1:42756462-42756484 TCCAAGCAGCAGGAGGAGGAAGG + Intronic
908034823 1:60040627-60040649 TGCGAGGAGCATGAGGAGTTCGG + Intronic
908968902 1:69801250-69801272 TTCCAAAAACTTGAGGAGGAAGG - Intronic
909375805 1:74940655-74940677 GTCCAGGAGGGAGAGGAGGAAGG - Intergenic
909666900 1:78144274-78144296 TTCTTGGAGAATGAGGATGAGGG + Intergenic
911210406 1:95132946-95132968 TTCCAGGAGAGTGATGTGGATGG + Intronic
911706544 1:101020426-101020448 TACCTGGAGCCAGAGGAGGAGGG - Intronic
911798619 1:102106250-102106272 TTCCAGGAACATGAAGATAACGG - Intergenic
911947900 1:104135764-104135786 TTCCAGGGGCATTTGGCGGAAGG + Intergenic
912718721 1:112002067-112002089 TTCCAGGAGAGAGATGAGGAGGG + Intergenic
912816480 1:112832823-112832845 TCCCAGAAGCAAGAGGAGGAAGG + Intergenic
913050548 1:115113546-115113568 TTCGAGGAGCTTGAGGAAGATGG - Intergenic
913067019 1:115265341-115265363 TTCCAGGACCATGAGGAGACTGG - Intergenic
913380005 1:118200124-118200146 TACGAAAAGCATGAGGAGGAAGG + Intergenic
913541431 1:119824932-119824954 TGTCAGGAGCTTGAGGAGGTAGG + Intergenic
914246847 1:145892545-145892567 AACCAGGATCACGAGGAGGAGGG + Exonic
914806492 1:150995805-150995827 TTCCTGGAGAATGAGGGTGAGGG - Intergenic
915892458 1:159784298-159784320 TTGCAGGAGCCTTGGGAGGAAGG - Intergenic
916006097 1:160662294-160662316 TTCCAAGAAATTGAGGAGGAGGG - Intergenic
916193118 1:162198096-162198118 TTCTAGGAGCATGATGAGGGAGG + Intronic
916593907 1:166223568-166223590 TTCCAAAAGATTGAGGAGGAGGG - Intergenic
916774002 1:167940484-167940506 TTCCAGGAGGCTGAGGTGGGAGG - Intronic
917580817 1:176376168-176376190 TTTCAGGAGCCCTAGGAGGATGG + Intergenic
918105668 1:181413384-181413406 TTCCAGGTGCAGGAGGGCGAGGG + Intronic
918110029 1:181447420-181447442 ATCCAGGAGCCTGAGGTGGGAGG + Intronic
918702147 1:187618427-187618449 GATCAGGAGCATGGGGAGGAAGG - Intergenic
919115753 1:193278545-193278567 TACCAGGGGCATGGGGAGGGGGG - Intergenic
919229354 1:194753795-194753817 TGCCAGGAGCATGAGATGGAAGG + Intergenic
920004694 1:202824394-202824416 TATCAGCAGTATGAGGAGGAAGG + Intronic
920054280 1:203181276-203181298 ATCCAGGTGTCTGAGGAGGAAGG + Exonic
920192331 1:204201659-204201681 TTCCAGGAACATGCCGAGGAGGG + Exonic
920375323 1:205505047-205505069 TTCCAGGTGCTTGAGAGGGAGGG + Intronic
920405059 1:205702955-205702977 TTCCTGTAGGATGGGGAGGAAGG - Intergenic
920641919 1:207760785-207760807 TGGCAGGAGCAGGAGGAGCAAGG + Intronic
920798308 1:209161818-209161840 TTCCAGGAACATGAAGATAATGG - Intergenic
920845971 1:209593381-209593403 TTCAAGGAGTATGAGGGAGAGGG + Intronic
920913100 1:210235016-210235038 ATTCAGGAGCCTGAGGATGAAGG + Intronic
921117913 1:212112079-212112101 GTCCAGGAGCAAGATGAGGATGG - Intergenic
921585014 1:216935991-216936013 TTCCTGGAGGATGAGGGGTATGG + Intronic
922113708 1:222589121-222589143 TTCGAGGTGCGTGTGGAGGAGGG + Intronic
922157599 1:223052285-223052307 TTCCAGGAGGGAGAAGAGGAGGG - Intergenic
922352802 1:224748098-224748120 TTCCAGGTACAGGAGGAGGAGGG - Intergenic
922604864 1:226883708-226883730 AGCCAGGAGAACGAGGAGGACGG + Exonic
922679126 1:227576284-227576306 TTCCAAAAGCTTGAGGAGAAGGG - Intronic
922742700 1:228023103-228023125 TCCAGGGAGCAGGAGGAGGAGGG - Intronic
922928028 1:229366807-229366829 ATTCAGGAGGCTGAGGAGGATGG + Intergenic
924511873 1:244734493-244734515 TTCCAAGAGCATGAAGATAAAGG - Intergenic
924513301 1:244746323-244746345 TTCCAGGAACATGAAGATAAAGG - Intergenic
1062971647 10:1653379-1653401 GTCCAGGGGCATGAAGAGGCTGG + Intronic
1063481150 10:6377835-6377857 CTCCAGGAGAAGGTGGAGGATGG + Intergenic
1063780630 10:9318459-9318481 TACCAGGAGCTTGAGAAGGGTGG + Intergenic
1063832819 10:9975541-9975563 TTCCAAGAAATTGAGGAGGAGGG + Intergenic
1064768458 10:18698711-18698733 TACAAGCAGCATTAGGAGGATGG - Intergenic
1065001372 10:21340698-21340720 TTCAAGGAGCCTGGGGAGGGTGG - Intergenic
1065220368 10:23490505-23490527 TTGCTGGATCATGAGGAGGGGGG + Intergenic
1065499991 10:26370729-26370751 TTCCAAAAAAATGAGGAGGAGGG - Intergenic
1065672311 10:28133370-28133392 TTCAAGTTGAATGAGGAGGAGGG - Intronic
1067052326 10:43029040-43029062 TTGCAGGAGCATGGGTATGAAGG + Intergenic
1067329741 10:45303954-45303976 TTACAGCAGCATGATGAGCAAGG - Exonic
1067617397 10:47766009-47766031 TGCAAGGACCATGAGGACGAGGG - Intergenic
1067785393 10:49242045-49242067 GTCCAGGGGCCTGAGGATGAGGG + Intergenic
1068511789 10:57975425-57975447 TTCCAGAAAATTGAGGAGGAGGG + Intergenic
1069330406 10:67285011-67285033 TTCCAGGAACATGAAGATAATGG - Intronic
1069569099 10:69483782-69483804 GCCCAGGAGGATGAGGATGATGG - Exonic
1069717652 10:70531266-70531288 TGCCAGGAGCCCGAGGGGGAAGG - Intronic
1069777182 10:70933999-70934021 CTCTAGGAGCAGGAGGAAGAAGG + Intergenic
1069884707 10:71616310-71616332 TTCCAGCGCCATGGGGAGGATGG + Intronic
1070261300 10:74858391-74858413 TTCCAGGACCCTGAGGTGGGAGG - Intronic
1070303760 10:75225541-75225563 TTCCAGGAACATGAAGATAATGG + Intronic
1070644137 10:78189708-78189730 ATCATGGAGCATTAGGAGGAGGG + Intergenic
1070829507 10:79409850-79409872 TTGGAGGAGCAGGGGGAGGACGG + Intronic
1070838613 10:79467824-79467846 TCCCTGGAGCCTGAGGAGGTTGG - Intergenic
1072520675 10:96227355-96227377 TTCCAGGCCCATGGGGAGGTGGG - Intronic
1072541042 10:96398151-96398173 TTCCAGGCCCAAGAGGGGGATGG + Intronic
1072554080 10:96501401-96501423 GTCCTGGAGCATGAGGATGCAGG - Intronic
1073299489 10:102462114-102462136 TTCCAGCCGGAGGAGGAGGATGG + Intronic
1073332119 10:102677110-102677132 TCCCAGGAGGAGGAGGAGGGAGG + Intronic
1075073159 10:119332348-119332370 TTTCAGGAGGCTGAGGAGGGAGG - Intronic
1075462344 10:122625363-122625385 TTCCAGAAGTAGGAGGAGTAGGG + Intronic
1075631667 10:124004207-124004229 TGCCAGCAGCATGAGGAGGCCGG - Intergenic
1075686133 10:124366612-124366634 TTCAAGGAGCAGGGAGAGGAAGG + Intergenic
1075687021 10:124371342-124371364 TTCCAGGAGATGGAGGAGCAAGG - Intergenic
1076068092 10:127464700-127464722 TCATAGGAGCAGGAGGAGGATGG + Intergenic
1076191204 10:128484593-128484615 TTCCAGAACCATGAGGATGGGGG + Intergenic
1076352503 10:129826828-129826850 TTTCAGGAGGCTGAGGAGGGAGG + Intergenic
1076610287 10:131722149-131722171 TTCCATGAGCCTCAGGAGGTGGG - Intergenic
1077201700 11:1310617-1310639 TCCCAAAAGCACGAGGAGGAAGG - Intergenic
1077407978 11:2391158-2391180 TGCCAGGGGCACCAGGAGGAAGG - Intronic
1078122881 11:8528312-8528334 TTCCAGGAATATGAGGATAATGG - Intronic
1078929344 11:15901305-15901327 TCCCTGGAGCCAGAGGAGGATGG + Intergenic
1079185501 11:18232290-18232312 CCCCAGGAGTATGTGGAGGAGGG + Intronic
1079445578 11:20553722-20553744 CTCAAGGAGGAGGAGGAGGAAGG - Intergenic
1079777962 11:24558114-24558136 ATCCAAGAGCAGGAGAAGGATGG - Intronic
1079834072 11:25309045-25309067 GAGCAGGAGCAAGAGGAGGAAGG - Intergenic
1079969614 11:27020180-27020202 TTCCAGGAGCACAAGAAGAAAGG + Intergenic
1081528576 11:43943091-43943113 ATCCAGGAGGTGGAGGAGGAGGG + Exonic
1081706312 11:45183690-45183712 TTTCAAGGGTATGAGGAGGAAGG + Intronic
1081804317 11:45882073-45882095 TTCCAGGAGCAGTAGGTGGGAGG + Exonic
1081806688 11:45894740-45894762 CTCCAGGAGCAAGGGGAGGAAGG + Intronic
1082159994 11:48880291-48880313 TTCCAGGAGGAGGAGGAGCACGG + Intergenic
1082162782 11:48901979-48902001 TTCCAGGAGGAGGAGGAGCATGG - Intergenic
1082175181 11:49049957-49049979 TTCCAGGACGAGGAGGAGCACGG - Intergenic
1082238636 11:49850755-49850777 TTCCAGGAGGAGGAGGAGCACGG + Intergenic
1082657998 11:55874383-55874405 TTCCAGGAGGAGGAGGAGCACGG - Intergenic
1083019129 11:59488494-59488516 TTCTAGTATCATGTGGAGGAGGG - Intergenic
1083652135 11:64209860-64209882 CTCCAGGAGCATGAACAGGTGGG - Intronic
1084201393 11:67560875-67560897 TTCCAGGAGCATGAAGATAATGG - Intergenic
1084639450 11:70415882-70415904 ATCCAGAAACATGAAGAGGAGGG - Intronic
1084693824 11:70742228-70742250 TGCCAGCAGAAGGAGGAGGAAGG - Intronic
1084721358 11:70907462-70907484 TTTCAGGAGCCTGAGAAGGGGGG - Intronic
1085250709 11:75141873-75141895 CTCCAGTAGAATGTGGAGGATGG + Intronic
1085387864 11:76167513-76167535 GTCGAGGAGCCTGAGGAGGGCGG + Intergenic
1085401349 11:76237690-76237712 TCCCAGGAGGCTGAGGAGGGTGG + Intergenic
1086003496 11:82008132-82008154 TTCCAGAAACCTGAGGATGAGGG - Intergenic
1086015712 11:82164774-82164796 TTCCATAAACTTGAGGAGGAGGG + Intergenic
1086690586 11:89786127-89786149 TTCCAGGACGAGGAGGAGCACGG + Intergenic
1086697936 11:89865395-89865417 TTCCAGGAGGAGGAGGAGCACGG - Intergenic
1086708226 11:89979093-89979115 TTCCAGGAGGAGGAGGAGCACGG + Intergenic
1086715213 11:90053533-90053555 TTCCAGGACGAGGAGGAGCACGG - Intergenic
1087182602 11:95154646-95154668 CTGCAGGAGCATTTGGAGGAGGG - Intergenic
1087532516 11:99402609-99402631 TTCCAGAAACTAGAGGAGGAGGG - Intronic
1087663984 11:101021071-101021093 TTTCAGGAGGATGAGGTGGGAGG - Intergenic
1088013498 11:105032621-105032643 TTAGAGGTGCATGAGAAGGAAGG + Intronic
1088058107 11:105610131-105610153 TTGCAGGTTCGTGAGGAGGACGG - Exonic
1088720744 11:112589968-112589990 TCCCAGGACCATGAGGTGAAGGG + Intergenic
1089083654 11:115798608-115798630 TACCAGGAAGAGGAGGAGGACGG - Intergenic
1089421609 11:118336063-118336085 TTTTAGGAGGCTGAGGAGGAAGG + Intergenic
1089650187 11:119907858-119907880 GGCCAGGGGCATGGGGAGGAAGG + Intergenic
1089787175 11:120916040-120916062 TCCTAGAAGAATGAGGAGGAAGG + Intronic
1090144854 11:124310668-124310690 TCCCAGGAACAGGAGGAAGAGGG + Exonic
1091410833 12:238089-238111 TTCTAGGAGAATGGGAAGGAAGG + Intronic
1091466380 12:688486-688508 TTCCAGGAACATGAAGACAATGG + Intergenic
1091486392 12:893146-893168 TCTCAGGAGGCTGAGGAGGAAGG + Intronic
1091536034 12:1410380-1410402 TCCCTGTAGGATGAGGAGGAGGG + Intronic
1093684756 12:22043728-22043750 TTCCAGGAAGAGGAAGAGGATGG - Intergenic
1094596319 12:31869944-31869966 TCCCAGGAGGTTGAGGAGTAGGG + Intergenic
1094741979 12:33300182-33300204 TTCCAAGAAGAAGAGGAGGAGGG + Intergenic
1095930000 12:47615867-47615889 TTCTAGGACCATGAGGAAGGAGG + Intergenic
1096524221 12:52201034-52201056 TTGGAGGAGGAGGAGGAGGAGGG - Intergenic
1097135514 12:56850466-56850488 TTCCAAGAAACTGAGGAGGAGGG - Intergenic
1097232994 12:57523252-57523274 TTCCCTCAGCTTGAGGAGGAGGG - Intronic
1097321790 12:58233733-58233755 TCCAAGGGGCATGAGGAGTAAGG + Intergenic
1097698634 12:62798689-62798711 TGGCAGGTGAATGAGGAGGAAGG - Intronic
1097729688 12:63114368-63114390 TTCCAAAAACTTGAGGAGGAGGG + Intergenic
1098210221 12:68156020-68156042 ATCCAGGTGCATGAAGTGGAAGG + Intronic
1098655845 12:73028293-73028315 TGACAGGAGCAGGAGGAAGAGGG - Intergenic
1100387169 12:94114300-94114322 CTACAGGAGCCTGAGGAAGAAGG + Intergenic
1101627610 12:106461019-106461041 TTTCAGGAGAATGAGGAGGTAGG - Intronic
1101800929 12:108021499-108021521 ATGAAGGAGCAGGAGGAGGAAGG - Intergenic
1102487711 12:113269423-113269445 TTCCATGAGCAGGATGTGGAAGG - Intronic
1103212729 12:119178688-119178710 CTCCTGGAGCAAGAGGAGGGCGG + Exonic
1103348088 12:120264761-120264783 TGCCAGGGGAATGAGGTGGAAGG - Intronic
1103437484 12:120937960-120937982 TTCCATGAGCAGGAGTAGGGAGG - Intergenic
1103459082 12:121089589-121089611 TTCCAGAAGCAGGTGGAAGATGG + Intergenic
1103721154 12:122976279-122976301 CTCCAGGGGAAGGAGGAGGAGGG - Exonic
1103884379 12:124189739-124189761 CTCCAGGGGCTTTAGGAGGAGGG + Intronic
1104350256 12:128039105-128039127 TCCCAGGATCAGGAGGAGGTAGG - Intergenic
1104746243 12:131212192-131212214 TGCCAGGAAGCTGAGGAGGAGGG - Intergenic
1104963371 12:132498495-132498517 CTCCAGGGAAATGAGGAGGATGG + Intronic
1105321068 13:19323008-19323030 GAACAGGAGCATGAGGAGGGAGG + Intergenic
1105729736 13:23200891-23200913 TTCCTGGAGCAGGAGGAGTCAGG + Intronic
1106061165 13:26293927-26293949 TACCAGGGGCTGGAGGAGGAGGG - Intronic
1106066956 13:26362522-26362544 TTCCAAGAGCAGGAGAAGAAAGG + Intronic
1106500482 13:30323630-30323652 TTGCAGCAGCAGTAGGAGGAGGG + Intergenic
1106699296 13:32211745-32211767 TTCAAGGAATTTGAGGAGGATGG - Intronic
1106805586 13:33303159-33303181 TTTCATGGGAATGAGGAGGAAGG - Intronic
1107708062 13:43126486-43126508 TTCCAGGATAATGAGAATGATGG - Intergenic
1107795855 13:44051006-44051028 TTCCAGGTGCAAAAGGAGGATGG - Intergenic
1107985779 13:45775107-45775129 TTGCAGGACCATGAGGTGGGTGG + Intergenic
1108146551 13:47483507-47483529 TGACAGGAGCATGGGGAGGTTGG + Intergenic
1108437938 13:50419702-50419724 TTACAGCAGGAGGAGGAGGAGGG + Intronic
1108729770 13:53222738-53222760 GACCAGTAGCAGGAGGAGGATGG + Intergenic
1109528138 13:63603505-63603527 TTCCAAAAACTTGAGGAGGAAGG + Intergenic
1109796534 13:67321014-67321036 TACCAGGTGCTGGAGGAGGAGGG - Intergenic
1110255318 13:73427208-73427230 GCCCAGGAGATTGAGGAGGATGG + Intergenic
1110283414 13:73721659-73721681 TCCCAGGAGGCTGAGGCGGAAGG - Intronic
1110484224 13:76019481-76019503 CTCCAGGAGTATGAGCAGCATGG - Intergenic
1111722154 13:91959500-91959522 TTCCAAAAACATGAGGAGGAAGG + Intronic
1113385470 13:109843913-109843935 TGCCAGGAGCTGGGGGAGGAAGG - Intergenic
1116077957 14:40136087-40136109 TTCCACAAAAATGAGGAGGAAGG - Intergenic
1116095603 14:40363163-40363185 TTCCAGGAACATGAAGATAATGG - Intergenic
1116848313 14:49884712-49884734 TTCCAGGAACATGAAGACAATGG - Intergenic
1118198437 14:63649792-63649814 TTCCAGGAACATGAAGATAATGG - Intergenic
1118354426 14:65000965-65000987 TTCCAGGAACATGAAGATAATGG + Intronic
1118636419 14:67752368-67752390 TTCCAGGCAGTTGAGGAGGATGG + Exonic
1118924266 14:70177648-70177670 TTCCAGAAGGATGAGCAGTATGG + Intronic
1119320356 14:73726714-73726736 CCACAGGAGCATGAGGAGGGAGG + Intronic
1119516569 14:75253002-75253024 ATTCAGGAGGATGAGGAGGGAGG + Intronic
1120213126 14:81654044-81654066 TTACAGGAACATGGGGAGGGAGG - Intergenic
1120470520 14:84918064-84918086 TGCCAAGAGGAGGAGGAGGAAGG - Intergenic
1120542692 14:85769807-85769829 TTACAGGAGCAGGCAGAGGATGG + Intergenic
1120889153 14:89476352-89476374 TGCCGGGAGTCTGAGGAGGAAGG - Intronic
1121551584 14:94806866-94806888 CTCCAGGAGCAAAAGCAGGAAGG + Intergenic
1121552738 14:94814643-94814665 TCCCAGCAGCATGAGGATGGAGG + Intergenic
1121586652 14:95067574-95067596 TTCCAGCAGCATGAGGGGGAGGG + Intergenic
1121610041 14:95272303-95272325 CTCCAGGAAGAGGAGGAGGAGGG + Intronic
1122068108 14:99187776-99187798 CTCCAGGAGGAGGAGGAGGAAGG - Intronic
1122379753 14:101294271-101294293 TTCCAGGAACATGAAGACAATGG + Intergenic
1122425832 14:101604793-101604815 TTCCCTCAGCATGAGGATGAGGG + Intergenic
1122470523 14:101963094-101963116 TTTAAGGAGCATGTGGAAGAGGG - Intergenic
1122655162 14:103253860-103253882 TTCCAGGAGCATGAAGATAATGG + Intergenic
1122823449 14:104358599-104358621 TTTCAGGAGCATGAGGAGGTGGG + Intergenic
1122835628 14:104429499-104429521 TTCCTGAAACATGAGGAGGGTGG - Intergenic
1123977572 15:25567710-25567732 TTCCAGGAGCCTGGCTAGGAGGG + Intergenic
1124142046 15:27086224-27086246 CCCTAGGAGCAGGAGGAGGAAGG + Intronic
1124205746 15:27718638-27718660 TTCCAGGAGAGGGAGGAGGATGG - Intergenic
1124531126 15:30507614-30507636 GAACAGGAGCATGAAGAGGATGG + Intergenic
1124767529 15:32500082-32500104 GAACAGGAGCATGAAGAGGATGG - Intergenic
1125720452 15:41842688-41842710 TTCAGAGAGCATGAGGATGAGGG - Intronic
1126144809 15:45464466-45464488 TTTAAGGAGCAGGAGGAGGTTGG + Intergenic
1126421308 15:48476091-48476113 TTCCAAGGAAATGAGGAGGAAGG + Intronic
1127001425 15:54512336-54512358 TTCCATGAGCAGAAGAAGGAAGG + Intronic
1127730967 15:61801660-61801682 TCCTGGAAGCATGAGGAGGAGGG - Intergenic
1128061112 15:64736618-64736640 CTCCAGGAGCAAGGGGAGCAAGG - Intergenic
1128138698 15:65283548-65283570 TTCCAGGAGGAGTAGCAGGATGG - Intronic
1128558096 15:68645335-68645357 CTCCAGGGGGATGACGAGGAAGG - Exonic
1128926432 15:71660471-71660493 TATCAGGAGCATGCAGAGGAAGG - Intronic
1129450497 15:75648547-75648569 GCCCAGGAGCAAGAGGAGGAAGG + Exonic
1129522713 15:76195982-76196004 TTCCAGGAGGAGGAGGAGGGAGG + Intronic
1129664684 15:77572912-77572934 TTCCTGGAGGAAAAGGAGGAGGG + Intergenic
1129672838 15:77616617-77616639 TTGCAGGTGCAGGGGGAGGAGGG - Intronic
1130603373 15:85293462-85293484 TCCCAGGATCCTGAGGAAGATGG + Intergenic
1130836650 15:87656404-87656426 TTCCAGGAACATGAAGATAATGG + Intergenic
1131054197 15:89365927-89365949 TTCCTGGAGCTGCAGGAGGAGGG + Intergenic
1131096105 15:89655231-89655253 TTCCAGGAGGCTGGGGAGCAAGG + Intronic
1131482716 15:92795561-92795583 TTTCAGGAGCAGGGGGAGCATGG + Intronic
1131536277 15:93240432-93240454 TGCCAGGAGGATGGGGAGGCAGG + Intergenic
1131589854 15:93736971-93736993 TTCCAGAAGATTGAGGAGGAGGG - Intergenic
1131905049 15:97133888-97133910 TGACAGGAGGCTGAGGAGGAGGG + Intergenic
1131959815 15:97777526-97777548 TTCCAAAACCATAAGGAGGAGGG + Intergenic
1132055688 15:98649027-98649049 AGCCAGGAGGAGGAGGAGGAGGG + Exonic
1132885946 16:2181987-2182009 TACCTGGAGCTGGAGGAGGAAGG + Intronic
1132975765 16:2710381-2710403 TGCCACGAGCTTTAGGAGGAAGG - Intergenic
1133536119 16:6704043-6704065 TTCAAAGAGCTCGAGGAGGAGGG - Intronic
1133873259 16:9709418-9709440 TTCCAGGAGAAGGGGAAGGAAGG - Intergenic
1133994739 16:10739911-10739933 TTGCAGGACCAGGAGGAGGAGGG + Intergenic
1135079873 16:19424876-19424898 TTCCTGGAGGATGAGGGGCAAGG + Intronic
1135198638 16:20417533-20417555 AACCAGGAGCTGGAGGAGGAGGG + Intronic
1135217642 16:20586672-20586694 TTCCTGGAGATTGAGGAGGGAGG - Intergenic
1135398251 16:22147473-22147495 TTTCTGGGGCATCAGGAGGAGGG + Intronic
1135800064 16:25485679-25485701 TTCCAAAAACTTGAGGAGGAGGG - Intergenic
1136188894 16:28603931-28603953 CACCAGGAGCATGAGGGGGCAGG - Intergenic
1137391719 16:48086889-48086911 TTTCTGTAGCATGTGGAGGAGGG + Intronic
1137458306 16:48635148-48635170 ATTCAGGAGGCTGAGGAGGAAGG + Intergenic
1137659672 16:50193755-50193777 TTCCTGAAGGATGAGGAGGAGGG + Intronic
1137711775 16:50571721-50571743 CTCCAGGAGCAACAGGATGATGG - Intronic
1138491252 16:57378085-57378107 TTCCTGGAGCAAGAAGAGTAAGG - Intronic
1139163165 16:64535720-64535742 TTCCAGATGGATGAGGAGTAGGG + Intergenic
1139962818 16:70727754-70727776 CCACAGGAGCATGGGGAGGATGG + Intronic
1140674648 16:77315992-77316014 TTCCCTGAGCATCTGGAGGATGG - Intronic
1141138993 16:81484926-81484948 TTTCAGGGGTAGGAGGAGGAAGG - Intronic
1141661386 16:85443445-85443467 TCTCAGTAACATGAGGAGGAAGG - Intergenic
1142505097 17:358098-358120 GTCCAGAAGGATGAGGTGGAGGG - Intronic
1142697191 17:1640108-1640130 GTCCAGGAGCGTGGGGCGGAGGG - Intronic
1143002289 17:3802008-3802030 TTCCAGCAGCCTGGGGAGCAGGG - Intergenic
1143365049 17:6401964-6401986 TGGCTGGAGCAGGAGGAGGAGGG + Intronic
1143374938 17:6461860-6461882 TTCCTGGAGGAGGAGGAGGGAGG - Intronic
1143783130 17:9239927-9239949 TTCCAGCAGCGTGAGAAGAAGGG + Exonic
1144669611 17:17125550-17125572 TCACAGGAGCTTGAGGTGGAGGG + Intronic
1144968622 17:19093395-19093417 TTGCAGGAAGAGGAGGAGGAGGG + Intronic
1144979293 17:19158668-19158690 TTGCAGGAAGAGGAGGAGGAGGG - Exonic
1144988929 17:19219564-19219586 TTGCAGGAAGAGGAGGAGGAGGG + Intronic
1146223495 17:31047001-31047023 TTAAAGGAGAATGAGGAGAAGGG + Intergenic
1146341491 17:32022967-32022989 TTAAAGGAGAATGAGGAGAAGGG - Intronic
1146682795 17:34820668-34820690 TTTCAGGAGCAGGAGGAAGATGG - Intergenic
1147162878 17:38578287-38578309 TTTCTGGAGCCTGGGGAGGAAGG - Intronic
1147321053 17:39646359-39646381 ACTCAGGAGCCTGAGGAGGAAGG - Intronic
1147904598 17:43814481-43814503 TTCCAGTAGCAGGAGGAGGTTGG - Intronic
1148002996 17:44401100-44401122 TTCAAGGACCATGCGGAGGAAGG - Exonic
1148362079 17:47019942-47019964 TTAAAGGAGAATGAGGAGAAGGG - Intronic
1149225040 17:54460135-54460157 TTCCAGGAACATGAAGATAATGG - Intergenic
1149469389 17:56903480-56903502 TTCCAGGAGCTGCTGGAGGAAGG + Intronic
1149538195 17:57448672-57448694 TTCCAGGAGCAGGAGCATGTTGG + Intronic
1149604773 17:57916877-57916899 TTCTCTGAGCAGGAGGAGGAGGG + Intronic
1151361778 17:73593383-73593405 TTCCTGCACAATGAGGAGGAAGG - Intronic
1151573281 17:74937900-74937922 TTCCAGGTGGGTGGGGAGGATGG + Intronic
1152235525 17:79136406-79136428 TGGCAGGAGCGTGGGGAGGAAGG + Intronic
1152411825 17:80129139-80129161 TTTCAGGAGCTTGAGGGGGGAGG - Intergenic
1152469592 17:80483304-80483326 TTCCAAGACGATGAGGAGGCTGG + Intergenic
1152908167 17:82981513-82981535 TTCCAGGAGCATGAAGATAATGG - Intronic
1153462160 18:5347806-5347828 TTCCAAAAAAATGAGGAGGAGGG + Intergenic
1155620109 18:27768692-27768714 TTCCAGGAGGCTGAGGAAGGAGG - Intergenic
1156360672 18:36381939-36381961 TTTCAGGAGCATGTCAAGGAAGG + Intronic
1156363114 18:36401492-36401514 TTCCAAGAGCATGAGAAGGAGGG + Intronic
1156421554 18:36959594-36959616 GTCCAGGAACAGGAGGAGAAAGG - Intronic
1157622030 18:49022262-49022284 TTCCAGGAGGCTGAGGCGGGAGG - Intergenic
1158111896 18:53949377-53949399 TTCCAGGAGCATTAGCACCATGG + Intergenic
1158673947 18:59501562-59501584 TTCCAGGAGGAGGAGGAAGCAGG - Intronic
1158757596 18:60345306-60345328 TGCCAAGAGGAGGAGGAGGAGGG + Intergenic
1158932917 18:62338648-62338670 TTCCAGGAGCTTGAGGGAGGGGG + Intronic
1159033800 18:63258148-63258170 TTCCAGGAGCTGGAAGAGGTGGG + Intronic
1159586655 18:70288980-70289002 CTCCTGGAGGAGGAGGAGGAAGG + Exonic
1159638271 18:70832685-70832707 TTCCAGAATAATGAAGAGGAGGG - Intergenic
1159740950 18:72169446-72169468 ATACAGGAGCAGGAGGAAGATGG - Intergenic
1160046489 18:75391554-75391576 TTGCAAGAGGATGAGGAAGAAGG + Intergenic
1160972300 19:1775048-1775070 CGCCCGGAGGATGAGGAGGAGGG - Intronic
1161630127 19:5350056-5350078 CTCCAGGAGGCTGAGGAGGGAGG - Intergenic
1161633012 19:5368696-5368718 TGCTAGGAGCATGAGGAGGATGG - Intergenic
1162016175 19:7847719-7847741 CTCCAGGAGCCTGGGCAGGAAGG - Exonic
1163377423 19:16942021-16942043 TGGCTGGAGCAGGAGGAGGAGGG - Intronic
1163499812 19:17669575-17669597 GTCCAGGAGGATGCGGTGGAAGG + Exonic
1163769255 19:19180720-19180742 TTCCAGGATCAGGCTGAGGAGGG + Exonic
1164517839 19:28951088-28951110 TTTCAGGAGGCTGAGGTGGAAGG - Intergenic
1165063461 19:33216079-33216101 TTCCCGGAGGAGGAGGAGGCAGG + Intronic
1165485412 19:36092567-36092589 TTCCAGGAGCATCTGGAGAATGG + Intronic
1165760658 19:38319633-38319655 TTCCAGGAGGACGAGAAGGAAGG + Intergenic
1165789849 19:38484721-38484743 CTTCAGGAGGCTGAGGAGGAGGG + Intronic
1166750694 19:45162785-45162807 TGCCAGGAGCACGGGGAGGGAGG + Intronic
1166861987 19:45816281-45816303 CACCAAGAGCATGGGGAGGAAGG + Intronic
1167596442 19:50430803-50430825 TCCCAGGAGGAGGAGGAGGAAGG + Exonic
1167767651 19:51494957-51494979 CTGCAGGAGGATGAAGAGGATGG + Intronic
1167792582 19:51690833-51690855 TGCCTGGGGCCTGAGGAGGAGGG - Intergenic
1168353304 19:55688330-55688352 TTCCAAGAGCAGGAGGGGAAGGG - Intronic
925112485 2:1347860-1347882 TTCCAGGAACATGAAGATGATGG - Intronic
926080551 2:9982677-9982699 TGCCAGGAGCATCAGCACGAGGG - Intronic
926164850 2:10515172-10515194 TTCCTAGAGAATGAGGAGGCAGG - Intergenic
926439397 2:12872103-12872125 TTCCAGGCCCAACAGGAGGAGGG + Intergenic
926888691 2:17620451-17620473 TTCCCTGAGAATGAGGAGGCGGG - Intronic
927513271 2:23657853-23657875 TGGCAGGAGCAGGAGCAGGAAGG + Intronic
928930399 2:36618152-36618174 TTCCAGGAACATGAAGATAATGG + Intronic
928955699 2:36865014-36865036 TTCCAGAAAATTGAGGAGGAGGG - Intronic
929483885 2:42338137-42338159 GGCCAGGAGCATGGGGAGTAGGG - Intronic
930362162 2:50394845-50394867 CTGGAGGAGCATGAGCAGGAAGG - Intronic
930900029 2:56495016-56495038 TTCCAAGAAATTGAGGAGGAGGG + Intergenic
931168758 2:59779740-59779762 TTTCATCAGAATGAGGAGGAGGG + Intergenic
931442391 2:62299444-62299466 TGCCAGGAGGAGGAGGAGGAGGG + Intergenic
931564537 2:63601673-63601695 TAGAAGGAGCAAGAGGAGGAGGG + Intronic
932586165 2:73030650-73030672 TTCCAGGAGCTGGAGAAGGGAGG - Intronic
934588297 2:95525511-95525533 TTCCAGGACGAGGAGGAGCACGG + Intergenic
935148951 2:100417017-100417039 TCCAAGGAGCATGCAGAGGAAGG - Intronic
936000450 2:108823229-108823251 TTCGAAGAATATGAGGAGGATGG - Intronic
936044035 2:109172377-109172399 CTCCAGGAGCAGGGAGAGGACGG - Intronic
936165523 2:110116394-110116416 TCCCAGGGGCATGAGCTGGAAGG - Exonic
936517406 2:113191095-113191117 TTCCAGATGCATAAGGAAGATGG + Intronic
937229312 2:120388316-120388338 TTGAAGGATAATGAGGAGGAAGG + Intergenic
937467600 2:122148387-122148409 TTACTGAAGCATGAGGGGGAGGG + Intergenic
937667771 2:124506296-124506318 TTCCAGGAGCAAGAAGATAATGG + Intronic
937907996 2:127061704-127061726 TTCCAGGAGCAGGAGAGGGAAGG + Intronic
938106532 2:128534914-128534936 TTCCAGGAACATGAAGATAATGG - Intergenic
938447304 2:131388991-131389013 GCCCTGGAGCATCAGGAGGAAGG - Intergenic
942322292 2:174746181-174746203 GTCCAAGGGCAAGAGGAGGAGGG - Intergenic
943524080 2:188994809-188994831 TTCCAGGAGCTGCAGGAGAAAGG + Exonic
944601854 2:201311251-201311273 TTCCAAAAAAATGAGGAGGAGGG + Intronic
944945002 2:204673692-204673714 ATACAGTAGGATGAGGAGGATGG - Intronic
945080100 2:206079835-206079857 TCCCAGGAGTTGGAGGAGGAGGG - Intronic
945128152 2:206536413-206536435 TACCAGGGGCAGGAGGTGGAGGG + Intronic
945430547 2:209758612-209758634 TTCCAAAAACCTGAGGAGGAGGG + Intergenic
946060085 2:216934200-216934222 TTCCAAGAGCACAGGGAGGAAGG + Intergenic
946075914 2:217073401-217073423 TTCCTGGAGCCTGGGGAAGATGG + Intergenic
946185828 2:217979871-217979893 ATCCAGGAGAAGGAGGTGGATGG - Intronic
947119374 2:226799661-226799683 TCCGAGGAGGAGGAGGAGGAGGG - Exonic
947302601 2:228705266-228705288 CCCCAGGAGTTTGAGGAGGAAGG - Intergenic
947530453 2:230905814-230905836 CTCCAGGAGCTTGAAGTGGAAGG - Intergenic
947612637 2:231533264-231533286 GGCCAGGAGCTAGAGGAGGATGG + Intergenic
948538421 2:238666136-238666158 TGCCAGGAGCAGGTGGAAGAAGG - Intergenic
948791429 2:240379412-240379434 TGCCTGGAGCGTGAGGAGCAGGG - Intergenic
948871202 2:240799124-240799146 CTCCAGGATCAAGAGCAGGAAGG + Intronic
948882954 2:240869607-240869629 TTTCTGGAGCATGTGCAGGACGG + Intronic
1169173305 20:3484725-3484747 TTCCAGAAGGATGCGAAGGATGG - Intronic
1169434146 20:5569991-5570013 TTGCAAGAGCATGAGAGGGAAGG + Intronic
1169993574 20:11530854-11530876 TTCCAAAAACTTGAGGAGGAAGG + Intergenic
1170502770 20:16991625-16991647 TTCCAGGAGTGAGAGGAGGATGG + Intergenic
1171309200 20:24132573-24132595 TTCCAGGAACATGAAGATCATGG - Intergenic
1171423467 20:25034395-25034417 TTCCAAGAGGATGAGGGGCAAGG - Intronic
1172614431 20:36274251-36274273 TTCCAGTAGCATCAGGAGAGGGG - Intergenic
1172911234 20:38410761-38410783 TGCCAGGAGCAGCAGGAGGGTGG - Intergenic
1173081490 20:39872544-39872566 TCTCAGGAGGCTGAGGAGGAAGG - Intergenic
1173575699 20:44111902-44111924 CTCCTGGAGCATGAGGGGAATGG - Exonic
1173700430 20:45065521-45065543 TTCCAGAAAATTGAGGAGGAGGG - Intronic
1173772185 20:45670267-45670289 TTCCAAAAACTTGAGGAGGAGGG + Exonic
1174093666 20:48070121-48070143 TTCCTGGGGGATGGGGAGGAGGG + Intergenic
1174665505 20:52254166-52254188 GTCCAGGGGAAGGAGGAGGAAGG - Intergenic
1175066349 20:56291823-56291845 TTCCAGGAGGCTGAGGTGGGAGG - Intergenic
1175144707 20:56886708-56886730 ATCCAGGAGGCTGAGGTGGAAGG + Intergenic
1175183490 20:57164850-57164872 TCCCAGGACGAGGAGGAGGAAGG + Intergenic
1175415404 20:58797492-58797514 TTCGAGGAGGCCGAGGAGGAAGG - Intergenic
1176020248 20:62959008-62959030 CTGCAGGAGCTGGAGGAGGAGGG + Intronic
1176085347 20:63293258-63293280 TCCCAGGAGTAGGAGGAGGTGGG + Exonic
1176128586 20:63486907-63486929 TTCCCTGAGGATGCGGAGGAGGG - Intergenic
1176128672 20:63487166-63487188 TTCCCTGAGGATGCGGAGGAGGG - Intergenic
1176360427 21:5991541-5991563 TTCCAGAAAATTGAGGAGGAAGG - Intergenic
1176914435 21:14608245-14608267 TACCAGGAGATAGAGGAGGAGGG - Intronic
1177385729 21:20407446-20407468 TTCCAGGAACATGAAGATAATGG + Intergenic
1179150652 21:38805882-38805904 CTTCAGGAGCGGGAGGAGGAGGG - Intronic
1179450487 21:41465402-41465424 GTCAGGGAGGATGAGGAGGAAGG + Exonic
1179453773 21:41484008-41484030 TTTCAGGAGGCTGAGGGGGAAGG + Intronic
1179763091 21:43547009-43547031 TTCCAGAAAATTGAGGAGGAAGG + Intronic
1179955504 21:44736046-44736068 TGCCAGGAGCTGGAGGAGGCAGG - Intergenic
1180080178 21:45483147-45483169 CTCCAGGAGCTTTGGGAGGAGGG + Intronic
1180228965 21:46414821-46414843 GTCCAGGAGGAGGAGGAGCAGGG - Intronic
1181378016 22:22475954-22475976 TTTTAGGAGGCTGAGGAGGAAGG - Intergenic
1181529977 22:23511856-23511878 TTCCAGCAGCATGGGGAGGAAGG + Intergenic
1181533437 22:23530079-23530101 TACAAGTACCATGAGGAGGAAGG + Intergenic
1181898605 22:26133269-26133291 TGACATGAGCATGAGAAGGATGG - Intergenic
1182064136 22:27418373-27418395 TTCCAGGAGACTGAGGAGTTGGG - Intergenic
1182427800 22:30284122-30284144 TTTCAGGAACATGGGGAGGGGGG - Intergenic
1182483676 22:30626572-30626594 TTCCAGGGACATCAGGAGGGAGG - Exonic
1182507476 22:30794686-30794708 TTCCAGGAGGCTGAGGTGGAAGG + Intronic
1182697741 22:32207883-32207905 TTCTTGTAGCATGTGGAGGAGGG + Intergenic
1182913706 22:34008802-34008824 TTCAAGGGGGAGGAGGAGGATGG - Intergenic
1183705424 22:39472571-39472593 TGCCAGGTGCTTGAGGAGGTAGG - Intronic
1183790814 22:40067687-40067709 GTTCAAGAGCAGGAGGAGGAGGG + Intronic
1184479111 22:44736867-44736889 GTGCAGGAGCACGAGGCGGAGGG + Exonic
1184520408 22:44990658-44990680 TACCAGGAGCCTGGGGAGGAAGG + Intronic
1185122738 22:48982234-48982256 TCCCAAGAGCATGGAGAGGAGGG - Intergenic
1185332509 22:50258063-50258085 TCCCAGGACCATGTGGGGGAGGG + Intronic
1185364674 22:50432001-50432023 TTCCAGGAGTTGGAGGAGAAGGG + Intronic
1185383614 22:50521655-50521677 TTCCTGGGGCATGAGGTGGGGGG + Intronic
949562764 3:5218047-5218069 TTCCAGGAGCATGAGGAGGAAGG - Exonic
950105166 3:10384045-10384067 TTTCAGGCACAGGAGGAGGAAGG - Intronic
950409706 3:12827557-12827579 TTCCTGAACCATGTGGAGGACGG + Exonic
950780199 3:15385202-15385224 TTCCAGGAACATGAAGATAATGG - Intronic
950866220 3:16191241-16191263 TTCCCGCAGCAGGAGGAAGAAGG - Intronic
951070549 3:18323517-18323539 TTCCAAGAAATTGAGGAGGAGGG + Intronic
951162811 3:19446583-19446605 TTCCAGGGCAATGAGGAGGTGGG + Intronic
951283700 3:20783233-20783255 CTCCAAAAACATGAGGAGGAGGG + Intergenic
951492131 3:23283137-23283159 TTACAGGAGCAAGTGCAGGAAGG - Intronic
952740342 3:36728545-36728567 TCCCAGGAGGAGGGGGAGGAGGG - Intronic
952998866 3:38912154-38912176 TTCCAGGAGTCTGCTGAGGATGG + Intronic
953976844 3:47388315-47388337 ATTCAGGAGGATGAGGTGGACGG - Intronic
954005625 3:47588232-47588254 GGCCAGGAGCAGGAGGCGGAGGG + Exonic
954261712 3:49443840-49443862 TTCCAGGAGCATGAAGATAATGG + Intergenic
954327865 3:49873375-49873397 TGCCAGGAATATGAGGAAGAGGG - Intergenic
955239438 3:57165872-57165894 TTCCAGGAGGGTGAGGGGGACGG - Intronic
955802688 3:62702343-62702365 TTCAAGGAGCATGAAGACCAAGG + Intronic
955872267 3:63451665-63451687 TTCCAGGATCATGTGGAGAGGGG - Intronic
956032186 3:65050507-65050529 TACTTGGAGCATGAGGATGACGG + Intergenic
956656563 3:71558432-71558454 TTCTAGGAGGCTGATGAGGAAGG + Intronic
958980414 3:100712492-100712514 TTCTTGGGGCAGGAGGAGGAAGG + Intronic
959900726 3:111658923-111658945 TTCCAGAAAATTGAGGAGGAGGG - Intronic
960047388 3:113211478-113211500 TGCGAGGAGGAGGAGGAGGAGGG - Exonic
960715599 3:120572042-120572064 TTCCAGGGGCATTGGGAGAAGGG + Intergenic
960992251 3:123319614-123319636 AACCAGGACCAGGAGGAGGAGGG - Intronic
961002164 3:123381302-123381324 TTCCAGGAGAATGGAGATGAAGG - Intronic
961029188 3:123587086-123587108 TTCCAGGAACATGAAGATAATGG + Intergenic
961050638 3:123742951-123742973 TGCCAGGAGCTGGGGGAGGAGGG + Intronic
961101452 3:124202601-124202623 GACCAGGAGGAGGAGGAGGAGGG - Intronic
961227364 3:125263900-125263922 TTCCTGGAGGTTGAGGAGAATGG - Intronic
961321346 3:126078496-126078518 CCCCAGAACCATGAGGAGGAAGG + Intronic
961346733 3:126268120-126268142 ATGCAGGAGGATGAAGAGGACGG - Intergenic
963370383 3:144392473-144392495 TTCCAGGGGCAAGAGGAGAATGG + Intergenic
963865897 3:150361044-150361066 TTCTAGGAGCATGAGAGAGATGG + Intergenic
963877171 3:150489364-150489386 TTCCAGGAACATGAAGATGACGG - Intergenic
964208704 3:154204032-154204054 TTCCAGGAAATAGAGGAGGAGGG - Intronic
968130303 3:196189208-196189230 TAGCAGGAGCATGAGGACCAAGG + Intergenic
968953009 4:3704235-3704257 TCCCAGGAGAATGGGGAGGGTGG + Intergenic
969503914 4:7571619-7571641 TTCCCTGAGCAAGTGGAGGAGGG + Intronic
969532568 4:7737990-7738012 TTCCAAGAGCATGTGGAGGGAGG + Intronic
970470884 4:16378482-16378504 TTCCAGGACCCAGAGGACGATGG - Intergenic
970511831 4:16788814-16788836 TTCCAGGAGTATAAGGAGGCAGG - Intronic
971633461 4:29026111-29026133 ATTCAGGAGGCTGAGGAGGAAGG + Intergenic
972541575 4:40043701-40043723 CGGCAGGAGCAGGAGGAGGAGGG - Intergenic
972683087 4:41325785-41325807 TTCCAGGAACATGAGGATAATGG + Intergenic
973149376 4:46867910-46867932 TTCCAGAAAACTGAGGAGGAGGG - Intronic
973583781 4:52371181-52371203 TTCCAGGAGCCTGAGAACCATGG + Intergenic
973618438 4:52703616-52703638 TTCCAGGAACATGAAGATAATGG - Intergenic
974193638 4:58540570-58540592 TGCCAGGACCATGACGGGGAGGG + Intergenic
975628439 4:76373908-76373930 TTCCAGGAGACTGAGGTGGGAGG + Intronic
976239742 4:82942644-82942666 TCCCAGGAGCAGGTGGTGGAGGG - Intronic
977583104 4:98746453-98746475 TGGCAGGAGGTTGAGGAGGAAGG - Intergenic
977864900 4:102013281-102013303 TTCCAGGAGCACCAAGAGTAGGG - Intronic
977948300 4:102939510-102939532 TTCCAAAAAAATGAGGAGGAAGG + Intronic
978350300 4:107814044-107814066 ATGCAGGAGGATGAGGTGGAAGG + Intergenic
978392531 4:108242142-108242164 TTTCAGGATTAGGAGGAGGAAGG + Intergenic
978960316 4:114670186-114670208 ATCCAGCAGCATGAGGCGGGTGG + Intronic
981210248 4:142094771-142094793 CTCCAGGAGCCTGAAGAGGTAGG - Intronic
981677043 4:147354257-147354279 TTCCAAGAGAAATAGGAGGAGGG - Intergenic
984743892 4:183194724-183194746 TTCCAGGCGGGTGAGGTGGAAGG + Intronic
984908865 4:184653223-184653245 TTCCAGGAGCAGCTGAAGGAGGG - Intronic
985219033 4:187683045-187683067 TGCAAGGAGAATGAGGAGGGTGG + Intergenic
986227419 5:5828622-5828644 TGCAAGTAGCATGAGGACGATGG - Intergenic
987878248 5:23709511-23709533 TTCAGGGAGCATGAGGAGGGAGG - Intergenic
988791301 5:34610308-34610330 TGGCAGGAGCAAGAGGATGAGGG - Intergenic
989180147 5:38568428-38568450 GTCCAGAAGCATGGGGAGGTTGG + Intronic
990037926 5:51345481-51345503 GTACAGGAGCATAAGGAGGAGGG + Intergenic
990196236 5:53319611-53319633 TTCCTGAAGGAGGAGGAGGATGG - Intergenic
990762918 5:59150375-59150397 TTCCAGGAGCATGTGTAGACTGG + Intronic
990976505 5:61565836-61565858 GTTCAGGAGCATGAAGAGGCTGG - Intergenic
991230512 5:64328018-64328040 TTCCAGAAGGAGGAGGAAGAGGG + Intronic
993018978 5:82567924-82567946 TTCCAAGAAAATGAGGAGGAGGG + Intergenic
993669332 5:90741142-90741164 TTCCACAGGGATGAGGAGGAAGG - Intronic
993911127 5:93686097-93686119 TTCCAGAAGCAAGTGGAGGTGGG + Intronic
993995260 5:94715042-94715064 TTAAAGGAAGATGAGGAGGAAGG + Intronic
994850273 5:105046317-105046339 GTCGAGGAGGAGGAGGAGGAGGG - Intergenic
996046250 5:118876833-118876855 TTCCAAAAGATTGAGGAGGAGGG + Intronic
996281050 5:121729288-121729310 TTACAGTAGGAAGAGGAGGAGGG - Intergenic
996560056 5:124819037-124819059 TTCCAAGGGCCTGAGGAGAAGGG - Intergenic
996673511 5:126148339-126148361 AGACAGGAGGATGAGGAGGAGGG - Intergenic
997801031 5:136862390-136862412 TTCCAGGAGTTGGAGGTGGAGGG - Intergenic
998359586 5:141573674-141573696 TTCCAGGACCACCAGGAAGAGGG + Exonic
998610784 5:143685856-143685878 TTAGAGGAGTAGGAGGAGGATGG + Intergenic
999203260 5:149831407-149831429 GTCCAGGACCAGGAAGAGGAGGG - Intronic
999267272 5:150275076-150275098 GTGCAGAAGGATGAGGAGGAAGG + Intronic
999783555 5:154870716-154870738 TTTCAGAAGCATGAAGAGGAAGG + Exonic
999809354 5:155113266-155113288 TTCAAGGATCATTTGGAGGAAGG + Intergenic
1000067265 5:157705384-157705406 TGCCTGGAGCATGAGGGTGAGGG - Intergenic
1000581882 5:163044999-163045021 TTCCAAAAACATGAGGAGAAGGG + Intergenic
1001411760 5:171517347-171517369 TTCCAAGAACAGGAGGAGGTTGG + Intergenic
1002288981 5:178187076-178187098 AGGGAGGAGCATGAGGAGGAGGG - Intergenic
1003131470 6:3398680-3398702 GTCAAGGAGCCTGAGGAGGCAGG - Intronic
1003226694 6:4212390-4212412 TTGCAGTAGCTGGAGGAGGAAGG - Intergenic
1003395747 6:5750578-5750600 TTGCAGGTGCAGGAGGAAGAAGG + Intronic
1003397171 6:5763341-5763363 TTTCAGGAGGCTGAGGTGGAAGG + Intronic
1003868884 6:10386047-10386069 AACCAGGAGGAGGAGGAGGAGGG + Intergenic
1004536211 6:16504954-16504976 TTGCAGGAGGAGGAGGAGGTGGG - Intronic
1004627448 6:17390203-17390225 TGGCAGGAGCAAGGGGAGGAGGG - Intergenic
1004749888 6:18551488-18551510 TTCCAGTAGTAGGAGGAGGCTGG + Intergenic
1005231310 6:23704642-23704664 TTCCAGGGGAAGGAGTAGGAGGG + Intergenic
1006265595 6:32919458-32919480 TTTCGGGAGGCTGAGGAGGACGG + Intergenic
1006474003 6:34243768-34243790 TTCTAGGAGCAGGAGAGGGAGGG - Intronic
1008137249 6:47791011-47791033 TTGGAGGAGGATGAGGTGGAAGG + Intronic
1008313690 6:50011724-50011746 TTCCAGGAGCATCATGAGGTAGG - Intronic
1009673499 6:66787729-66787751 CTCCAGGGACATGAGGAGGCTGG - Intergenic
1009864540 6:69380314-69380336 TTCCAGCAACATGGGAAGGATGG + Intronic
1010942305 6:81933183-81933205 TTCAAGGACAATGAGGTGGATGG + Intergenic
1011811882 6:91141653-91141675 TTCCAGGAAGAGAAGGAGGAAGG - Intergenic
1012077333 6:94707029-94707051 TTTCAGGAGAATGATGAGGGTGG + Intergenic
1012576985 6:100814477-100814499 TTCCAAGAAAATGGGGAGGAGGG - Intronic
1013480214 6:110546523-110546545 GTCCAGGAAGATGAGGAGGAAGG - Intergenic
1013645974 6:112141703-112141725 TTCCACGAGCCTGAGCAAGATGG - Intronic
1014336703 6:120146830-120146852 CTGCAGGAGCAGGAGCAGGAGGG - Intergenic
1014528630 6:122532528-122532550 TGCCAGGAGCTGGAGGAGAATGG - Intronic
1014994528 6:128125376-128125398 TGGCAGGAGCAGGAGCAGGATGG - Intronic
1015373959 6:132489458-132489480 TTCCTGGAGAATGTGAAGGATGG + Intronic
1015759535 6:136644012-136644034 GTCCAGGAGCAGGAGGTGGGAGG + Intronic
1016849604 6:148603619-148603641 TGCCAGGAGCTGGAGGTGGAGGG - Intergenic
1017085023 6:150705720-150705742 CCTCAGGAGCATAAGGAGGAGGG - Intronic
1017615016 6:156237288-156237310 TTCCAAAAACTTGAGGAGGAGGG - Intergenic
1017853553 6:158328169-158328191 TTGGAGGAGCAGGAGGAGGGAGG + Intronic
1017885252 6:158594042-158594064 TGCCAGGGGTGTGAGGAGGAGGG - Intronic
1017934579 6:158993642-158993664 TTCCAGGAGCTGGGGGATGAGGG - Intronic
1018001840 6:159586514-159586536 TTCCAGGGACCTGGGGAGGAAGG + Intergenic
1018083768 6:160282247-160282269 TTCCAGGAACTTGAAGAGGAAGG - Intergenic
1018577705 6:165276753-165276775 TTCCATGAGGATGAGGAGGAAGG - Intergenic
1018864784 6:167737861-167737883 CTCCAGGAGCATGGAGTGGAGGG - Intergenic
1019115989 6:169763111-169763133 TTCTAGGAGCCAGAGGAGGTAGG - Intronic
1019446109 7:1072164-1072186 CTCCAGGACCATGGGGAGGTGGG - Intronic
1019521312 7:1461686-1461708 GTCTTGGAGGATGAGGAGGAGGG - Intergenic
1019600157 7:1878271-1878293 TTCCAGAAAAAAGAGGAGGAGGG + Intronic
1020225655 7:6277949-6277971 TTCCAGGAGGCTGAGGTGGGAGG - Intergenic
1020511424 7:9061704-9061726 TTTCAGGAGGCTGAGGTGGAAGG - Intergenic
1020702644 7:11502243-11502265 TTCCAAAAGGATTAGGAGGAGGG + Intronic
1021019426 7:15578204-15578226 TTCCAGCAGCCTGAGCAGCAAGG - Intergenic
1021516012 7:21488106-21488128 CTCCAGGAGGCTGAGGAGGATGG - Intronic
1021992194 7:26150096-26150118 TTTTAGGAGCATGGGGAGAATGG - Intergenic
1022112215 7:27238832-27238854 TTCCAGGAGGGTGGAGAGGAGGG + Intergenic
1022467303 7:30660570-30660592 TACCAGGAGCACGAGAATGATGG + Exonic
1022498217 7:30866380-30866402 TTCCAGGAGCTGGAAGAGGCAGG - Intronic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1023130117 7:36994615-36994637 TTGCAGGAGTGGGAGGAGGAAGG - Intronic
1023913967 7:44574666-44574688 TTCCAGGAGACTGAGGTGGGAGG - Intronic
1024785850 7:52906506-52906528 TTCCAGGAGCAAGAAGATAATGG - Intergenic
1025916035 7:65866854-65866876 GTCGAGGAGGAAGAGGAGGAGGG + Intergenic
1026469164 7:70680100-70680122 TTCCATGAGAGTGGGGAGGAGGG + Intronic
1027141789 7:75662747-75662769 CTCCAGGAGGCTGAGGAGGATGG - Intronic
1027614452 7:80404032-80404054 TTCCAGGAGCATGAAGATAATGG - Intronic
1027619032 7:80460303-80460325 TGCCAGGAGTGTGAGGAGGGAGG + Intronic
1027863308 7:83613247-83613269 TGACAGGAGGATGAGGAGAAAGG - Intronic
1028652491 7:93166551-93166573 TTCCAGGACCATGAAGATAATGG + Intergenic
1028839103 7:95407938-95407960 TCACAGGAGCAAGAAGAGGAAGG + Intronic
1028925992 7:96357587-96357609 TTCCAGGAGCATGAGGATAATGG - Intergenic
1029489976 7:100865858-100865880 TCCCAGGAGCCCGGGGAGGAGGG - Exonic
1029627104 7:101726797-101726819 TTTCAGGGGCGGGAGGAGGAAGG - Intergenic
1029825640 7:103190584-103190606 TTCCAGGAAATAGAGGAGGAAGG + Intergenic
1030718733 7:112843749-112843771 TTCCAAAAGACTGAGGAGGAGGG + Intronic
1030801997 7:113863934-113863956 TTCCAGGAACATGAAGATAATGG + Intergenic
1030867929 7:114722108-114722130 ATCCAAGAGGAGGAGGAGGAGGG + Intergenic
1031257386 7:119471337-119471359 TTCCAAAAGAATGAGGAGTATGG + Intergenic
1031314961 7:120245050-120245072 ATCCAGAAGCATGAGGGAGATGG + Intergenic
1031595308 7:123643184-123643206 TTCTAGGAACAGGAGAAGGAAGG + Intergenic
1032132884 7:129245512-129245534 TTCCAGGGGCTGGGGGAGGAAGG - Intronic
1032280178 7:130493551-130493573 TTCTTGGAGTAAGAGGAGGAGGG + Intronic
1032330596 7:130975487-130975509 TTCCAGGCTCATGAGCAGAAGGG + Intergenic
1032726922 7:134598602-134598624 TTCCAAAAAAATGAGGAGGAAGG - Intergenic
1032965876 7:137096833-137096855 TTCCAAAAAAATGAGGAGGAAGG + Intergenic
1033030964 7:137826319-137826341 TTCCAGAAGGATTAGGACGATGG - Intronic
1033583008 7:142753532-142753554 TTCCAGGTGAATGAGAAGGGAGG - Intronic
1033584555 7:142764454-142764476 TTCCAGGTGAATGAGGAGGGAGG - Intergenic
1033586035 7:142775009-142775031 TTCCAGGCGAATGAGAAGGGAGG - Intergenic
1033600014 7:142882590-142882612 TGCCAGGAACATGAGCTGGAGGG - Intronic
1034102057 7:148458410-148458432 TACCAGGAGCTGGAAGAGGAAGG + Intergenic
1034430621 7:151039511-151039533 TGCCAGGAGGCTGAGGAGGAAGG - Intronic
1034470678 7:151252757-151252779 AGCCAGGAGGAGGAGGAGGAAGG - Intronic
1035045248 7:155961580-155961602 TGCCAGGAGCAAGGGGAGGAAGG + Intergenic
1035116294 7:156527134-156527156 TTCATGGAGGATGAGGGGGAAGG - Intergenic
1035181532 7:157092889-157092911 TTCCAGGAACATGAAGACAATGG + Intergenic
1035414695 7:158673211-158673233 TTCAAGGAGAAAGAGGAGCAAGG + Intronic
1035722057 8:1799318-1799340 TTGGAGGAGGAGGAGGAGGAGGG - Intergenic
1035843554 8:2838985-2839007 TCCTAGTAGCTTGAGGAGGAGGG - Intergenic
1035851813 8:2927460-2927482 TTCCAGTCGCCTGAGGAGGAAGG + Intergenic
1035988421 8:4460407-4460429 TTCCAGGACAGTGAGGTGGAAGG - Intronic
1036229306 8:6985900-6985922 TGGCAGGAGCATGGGGTGGAGGG + Intergenic
1036231758 8:7005004-7005026 TGGCAGGAGCATGGGGTGGAGGG + Intronic
1037229967 8:16646176-16646198 TTCCAGAAGCAAAAGGAAGAGGG + Intergenic
1038136106 8:24787460-24787482 TTCTATGAGCATAAGGAGGAAGG - Intergenic
1038428880 8:27484059-27484081 TTGCAGGAGGATGAGAAGGGGGG + Intergenic
1038716141 8:29992956-29992978 TCCCAGGAGGCTGAGGAGGGAGG - Intergenic
1039273875 8:35913705-35913727 TTCCAGGTTCCTGAGGATGATGG - Intergenic
1039433588 8:37544802-37544824 TTCTAGGGGTATGAGGAGAAGGG - Intergenic
1039600699 8:38834592-38834614 TTCCAGCAGCATTTGGGGGAGGG - Intronic
1039825244 8:41167866-41167888 TTCCAGGAATATGAAGATGATGG - Intergenic
1040714941 8:50239622-50239644 TTCCAGGAGAAAGTGGAGCAGGG - Intronic
1040961855 8:53042736-53042758 TTCCAAAAACTTGAGGAGGAGGG - Intergenic
1040995092 8:53393037-53393059 TTCTAGGTGCAGGAGGAGTAAGG - Intergenic
1041348145 8:56922740-56922762 ATGCAGGAGACTGAGGAGGAAGG + Intergenic
1042312076 8:67388798-67388820 TGGCAGGAGCAGGAGGAGGAGGG - Intergenic
1043352724 8:79379576-79379598 TTCCAGAAGGCTGAAGAGGAGGG + Intergenic
1044020680 8:87102301-87102323 TTACAGTAACATGAGAAGGAAGG + Intronic
1044214179 8:89587978-89588000 TTCCAAGAAAGTGAGGAGGAGGG + Intergenic
1044729782 8:95220526-95220548 AGCCAGGAGCAGGAGGAGCAGGG - Intergenic
1045251620 8:100487477-100487499 AACCTGGATCATGAGGAGGAGGG + Intergenic
1047505817 8:125479094-125479116 TTTCAGGGGGATGAGGATGAGGG + Intergenic
1047691110 8:127355538-127355560 CTCCAGGGGCATGATGAGGCTGG - Intergenic
1047699904 8:127438501-127438523 TTCCAGAAAATTGAGGAGGAGGG + Intergenic
1048155898 8:131950645-131950667 TTCCAGGAGCGTGAGGACTTTGG + Intronic
1048574736 8:135681608-135681630 TTCTAGGAACAGGAGGTGGAAGG - Intergenic
1049148530 8:141019639-141019661 TTCCAGGAGCAGGAGCAGCCTGG - Intergenic
1050580639 9:7051735-7051757 TTCCAGTTGTATGAAGAGGAAGG - Intronic
1051221325 9:14851354-14851376 TTCCAGGTGAATGAGGAGATTGG + Exonic
1051250573 9:15154593-15154615 ATCTAGGAAGATGAGGAGGAGGG + Intergenic
1051613758 9:18987279-18987301 TTCTTGGAGTATGAGGAAGAGGG - Intronic
1051890329 9:21935502-21935524 TTCCAGGAGCATGAACATAATGG + Intronic
1052868673 9:33482415-33482437 TTCCAGGAACATGAAGATAATGG - Intergenic
1052901775 9:33799670-33799692 TTCCAGGTGAATGAGAAGGGAGG - Intergenic
1053150655 9:35740734-35740756 TTACAGGAGTATGATGAGGGTGG + Intronic
1054750434 9:68899337-68899359 ATCCTGGAGCCTGAGGAGCAAGG + Intronic
1055329561 9:75169811-75169833 TTCCAGGAACATGAAGATAATGG - Intergenic
1056376495 9:86018725-86018747 GTTCAGGAGACTGAGGAGGAGGG - Exonic
1056495556 9:87151540-87151562 TTCCAGGAGCTCGTGGAAGATGG - Intronic
1057258820 9:93572738-93572760 TGCCAGGGGCTGGAGGAGGAGGG + Intergenic
1057862486 9:98652550-98652572 TTTCTAGAGCATGAGGAGGCTGG - Intronic
1058187979 9:101877543-101877565 ATCAAGGAGTATGAGGAGGACGG + Intergenic
1058473979 9:105311908-105311930 TTTCAGGAGAAAGAAGAGGATGG - Intronic
1059471588 9:114508924-114508946 CACCAGGAGCATGATGATGATGG - Intergenic
1059506729 9:114806009-114806031 CTCCAGGAGCAGCAGGAGCATGG - Exonic
1060070035 9:120538514-120538536 TTCCATGAGCACCAGCAGGATGG + Intronic
1060301047 9:122374841-122374863 CTCCAGGAGTAGGAGGAGGAGGG + Intronic
1060881350 9:127120409-127120431 TTCCAGGAGCCTGAGGAGAGGGG - Intronic
1061826807 9:133262988-133263010 TCCCAGGAGGCTGAGGTGGAAGG + Intronic
1061902593 9:133680633-133680655 CTCGAGGAGCGTGTGGAGGACGG - Intronic
1061966897 9:134019939-134019961 TTCCAGGAACATGAAGACAATGG + Intergenic
1061976509 9:134070597-134070619 TTCCAAGAGCCTGAGCAGGAAGG - Intergenic
1062076693 9:134593580-134593602 CTCCAGGCGCAGGTGGAGGATGG - Intergenic
1062103612 9:134740870-134740892 GTCCAGGAGCATGAGGACTGAGG + Intronic
1062714990 9:138005157-138005179 TGCCATGAGCATGAGGAGGCAGG - Intronic
1185455622 X:309224-309246 TTCCAAGTGCATGAAGAGCACGG - Intronic
1186258880 X:7754448-7754470 TTCTGGGAGCATAAAGAGGATGG + Intergenic
1186860536 X:13668230-13668252 TGCCAGGAGCATGTGGTGTATGG + Intronic
1187010104 X:15269938-15269960 TTTCAGGAGCAGGGGGAGCATGG - Exonic
1187094662 X:16134712-16134734 TTCCAGGAGTTTTAGGATGAAGG - Intronic
1187267852 X:17752282-17752304 CACCAGGACCACGAGGAGGAGGG + Intronic
1187321442 X:18242098-18242120 TGCCAGAACCATGAGTAGGAGGG - Intronic
1187548935 X:20281931-20281953 TCCCAGGAGGATGTGGAGTAGGG - Intergenic
1187847061 X:23550719-23550741 TTCCACCAGGATGAGGAGGGAGG - Intergenic
1188164479 X:26845124-26845146 TTCCAGGAGGCTGAGGAAGGAGG + Intergenic
1189173414 X:38931319-38931341 TTCTAGGATAAAGAGGAGGAGGG - Intergenic
1189336721 X:40175056-40175078 TTCCTGGTGCTTGGGGAGGATGG - Intronic
1189683434 X:43539971-43539993 TTCCAGGATAATAACGAGGAAGG + Intergenic
1191628307 X:63292574-63292596 TTCCAAAATCTTGAGGAGGAGGG + Intergenic
1191631438 X:63326120-63326142 TTTCAGGATGATGAGGAGTATGG - Intergenic
1192442040 X:71181768-71181790 TTCCGGGAGCCTGAAAAGGATGG - Intergenic
1192892240 X:75402836-75402858 TTCCAGAAAAATGAGGAGGAAGG + Intronic
1193353810 X:80492865-80492887 TTTCAGGAGCAATAGGAGGGGGG + Intergenic
1193446451 X:81610754-81610776 TTCCAGAAGCTAGAGGTGGAGGG - Intergenic
1193448881 X:81642115-81642137 TTCCAAAACCTTGAGGAGGAAGG - Intergenic
1194758675 X:97767982-97768004 TTCCAGGCCCAGGAGGAAGAAGG + Intergenic
1194980412 X:100434554-100434576 TTCCTGGAGCAGGAGGATGCAGG - Intergenic
1195243479 X:102976028-102976050 ATCCAGGAACATGAGGATAATGG - Intergenic
1195541126 X:106064271-106064293 TTCCAGAAATTTGAGGAGGAGGG - Intergenic
1195577491 X:106467769-106467791 TTCCAGGAACATGAGGAGCGGGG - Intergenic
1195697398 X:107677032-107677054 TTCCAGTGGGATGAGGAGGACGG + Intergenic
1195720436 X:107862149-107862171 TAGCAGGAGGAGGAGGAGGAGGG + Intronic
1196275790 X:113763919-113763941 TTCCATGAGCATGAGCAGCCTGG - Intergenic
1197377061 X:125693371-125693393 TTCCAGGAACATGAAGATAATGG - Intergenic
1197868708 X:131045685-131045707 TTCAAGCATCAGGAGGAGGAAGG + Intergenic
1198039257 X:132833649-132833671 TTCCAGGAGCATTCACAGGAAGG + Intronic
1198278908 X:135123329-135123351 TGCGTGGAGCATCAGGAGGAAGG + Intergenic
1198292051 X:135249191-135249213 TGCATGGAGCATCAGGAGGAAGG - Intronic
1198306868 X:135392088-135392110 TGCACGGAGCATCAGGAGGAAGG - Intergenic
1198665867 X:139022133-139022155 GGACAGGAGCAAGAGGAGGAAGG + Intronic
1199084616 X:143614525-143614547 TACCAGGAGCAGGAAGAGGGAGG + Intergenic
1200001138 X:153060313-153060335 TGCCAGGAACCTCAGGAGGAGGG + Intronic
1200071299 X:153530773-153530795 TACCAGGAACAGGGGGAGGAAGG + Intronic
1200389429 X:155929383-155929405 TTCCAGGAACATGAAGATAATGG + Intronic