ID: 949567043

View in Genome Browser
Species Human (GRCh38)
Location 3:5254489-5254511
Sequence AGCTTGCCCCAACACCATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949567043_949567044 -7 Left 949567043 3:5254489-5254511 CCAAGATGGTGTTGGGGCAAGCT No data
Right 949567044 3:5254505-5254527 GCAAGCTTCACATATTCCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949567043 Original CRISPR AGCTTGCCCCAACACCATCT TGG (reversed) Intergenic
No off target data available for this crispr