ID: 949568735

View in Genome Browser
Species Human (GRCh38)
Location 3:5270755-5270777
Sequence CAGGAAATGAGGGCAGCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949568735_949568744 23 Left 949568735 3:5270755-5270777 CCAGCGGCTGCCCTCATTTCCTG No data
Right 949568744 3:5270801-5270823 CCAAAACGTGCAAGTTGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949568735 Original CRISPR CAGGAAATGAGGGCAGCCGC TGG (reversed) Intergenic
No off target data available for this crispr