ID: 949570219

View in Genome Browser
Species Human (GRCh38)
Location 3:5285378-5285400
Sequence CTGTGATATTGGCAACTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949570210_949570219 17 Left 949570210 3:5285338-5285360 CCGAGTTCAGGTGGGAATAGTGT No data
Right 949570219 3:5285378-5285400 CTGTGATATTGGCAACTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949570219 Original CRISPR CTGTGATATTGGCAACTGGA TGG Intergenic
No off target data available for this crispr