ID: 949573155

View in Genome Browser
Species Human (GRCh38)
Location 3:5312598-5312620
Sequence CTTTCCATGCAGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949573155_949573161 10 Left 949573155 3:5312598-5312620 CCTTCCTCCTTCTGCATGGAAAG No data
Right 949573161 3:5312631-5312653 CCTAGGCAGTGCGAAGTCTAGGG No data
949573155_949573159 9 Left 949573155 3:5312598-5312620 CCTTCCTCCTTCTGCATGGAAAG No data
Right 949573159 3:5312630-5312652 TCCTAGGCAGTGCGAAGTCTAGG No data
949573155_949573158 -7 Left 949573155 3:5312598-5312620 CCTTCCTCCTTCTGCATGGAAAG No data
Right 949573158 3:5312614-5312636 TGGAAAGCAGTGTGACTCCTAGG No data
949573155_949573162 11 Left 949573155 3:5312598-5312620 CCTTCCTCCTTCTGCATGGAAAG No data
Right 949573162 3:5312632-5312654 CTAGGCAGTGCGAAGTCTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949573155 Original CRISPR CTTTCCATGCAGAAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr