ID: 949577666

View in Genome Browser
Species Human (GRCh38)
Location 3:5354594-5354616
Sequence TCGTTCTAGGCAAAGAATTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949577666_949577675 26 Left 949577666 3:5354594-5354616 CCCCAATTCTTTGCCTAGAACGA No data
Right 949577675 3:5354643-5354665 TCTTTGTTTTAGATTCAAGGGGG No data
949577666_949577672 23 Left 949577666 3:5354594-5354616 CCCCAATTCTTTGCCTAGAACGA No data
Right 949577672 3:5354640-5354662 TTATCTTTGTTTTAGATTCAAGG No data
949577666_949577673 24 Left 949577666 3:5354594-5354616 CCCCAATTCTTTGCCTAGAACGA No data
Right 949577673 3:5354641-5354663 TATCTTTGTTTTAGATTCAAGGG No data
949577666_949577674 25 Left 949577666 3:5354594-5354616 CCCCAATTCTTTGCCTAGAACGA No data
Right 949577674 3:5354642-5354664 ATCTTTGTTTTAGATTCAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949577666 Original CRISPR TCGTTCTAGGCAAAGAATTG GGG (reversed) Intergenic
No off target data available for this crispr