ID: 949577675

View in Genome Browser
Species Human (GRCh38)
Location 3:5354643-5354665
Sequence TCTTTGTTTTAGATTCAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949577667_949577675 25 Left 949577667 3:5354595-5354617 CCCAATTCTTTGCCTAGAACGAG No data
Right 949577675 3:5354643-5354665 TCTTTGTTTTAGATTCAAGGGGG No data
949577668_949577675 24 Left 949577668 3:5354596-5354618 CCAATTCTTTGCCTAGAACGAGG No data
Right 949577675 3:5354643-5354665 TCTTTGTTTTAGATTCAAGGGGG No data
949577671_949577675 13 Left 949577671 3:5354607-5354629 CCTAGAACGAGGATAAAGGCATC No data
Right 949577675 3:5354643-5354665 TCTTTGTTTTAGATTCAAGGGGG No data
949577666_949577675 26 Left 949577666 3:5354594-5354616 CCCCAATTCTTTGCCTAGAACGA No data
Right 949577675 3:5354643-5354665 TCTTTGTTTTAGATTCAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949577675 Original CRISPR TCTTTGTTTTAGATTCAAGG GGG Intergenic
No off target data available for this crispr