ID: 949577820

View in Genome Browser
Species Human (GRCh38)
Location 3:5355795-5355817
Sequence GTTATGCCAGATGTTATACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949577820_949577822 7 Left 949577820 3:5355795-5355817 CCCAGTATAACATCTGGCATAAC No data
Right 949577822 3:5355825-5355847 CAATTTCAAAACTAAGAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949577820 Original CRISPR GTTATGCCAGATGTTATACT GGG (reversed) Intergenic
No off target data available for this crispr