ID: 949578208

View in Genome Browser
Species Human (GRCh38)
Location 3:5359670-5359692
Sequence CCCAAGCATGACTTTTTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949578204_949578208 5 Left 949578204 3:5359642-5359664 CCAGAGGTCTGCTCTTTCGTGCT No data
Right 949578208 3:5359670-5359692 CCCAAGCATGACTTTTTTTGTGG No data
949578198_949578208 26 Left 949578198 3:5359621-5359643 CCCTGCCCTGAGGTTCTAGACCC No data
Right 949578208 3:5359670-5359692 CCCAAGCATGACTTTTTTTGTGG No data
949578203_949578208 6 Left 949578203 3:5359641-5359663 CCCAGAGGTCTGCTCTTTCGTGC No data
Right 949578208 3:5359670-5359692 CCCAAGCATGACTTTTTTTGTGG No data
949578202_949578208 20 Left 949578202 3:5359627-5359649 CCTGAGGTTCTAGACCCAGAGGT No data
Right 949578208 3:5359670-5359692 CCCAAGCATGACTTTTTTTGTGG No data
949578200_949578208 21 Left 949578200 3:5359626-5359648 CCCTGAGGTTCTAGACCCAGAGG No data
Right 949578208 3:5359670-5359692 CCCAAGCATGACTTTTTTTGTGG No data
949578199_949578208 25 Left 949578199 3:5359622-5359644 CCTGCCCTGAGGTTCTAGACCCA No data
Right 949578208 3:5359670-5359692 CCCAAGCATGACTTTTTTTGTGG No data
949578197_949578208 27 Left 949578197 3:5359620-5359642 CCCCTGCCCTGAGGTTCTAGACC No data
Right 949578208 3:5359670-5359692 CCCAAGCATGACTTTTTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949578208 Original CRISPR CCCAAGCATGACTTTTTTTG TGG Intergenic
No off target data available for this crispr