ID: 949582077

View in Genome Browser
Species Human (GRCh38)
Location 3:5398571-5398593
Sequence ATGTGGCTATGTTTGGAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949582077_949582086 8 Left 949582077 3:5398571-5398593 CCTATCTCCAAACATAGCCACAT No data
Right 949582086 3:5398602-5398624 AGGGCTTGAACATGTGAATTTGG No data
949582077_949582087 9 Left 949582077 3:5398571-5398593 CCTATCTCCAAACATAGCCACAT No data
Right 949582087 3:5398603-5398625 GGGCTTGAACATGTGAATTTGGG No data
949582077_949582090 15 Left 949582077 3:5398571-5398593 CCTATCTCCAAACATAGCCACAT No data
Right 949582090 3:5398609-5398631 GAACATGTGAATTTGGGGGTAGG No data
949582077_949582089 11 Left 949582077 3:5398571-5398593 CCTATCTCCAAACATAGCCACAT No data
Right 949582089 3:5398605-5398627 GCTTGAACATGTGAATTTGGGGG No data
949582077_949582088 10 Left 949582077 3:5398571-5398593 CCTATCTCCAAACATAGCCACAT No data
Right 949582088 3:5398604-5398626 GGCTTGAACATGTGAATTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949582077 Original CRISPR ATGTGGCTATGTTTGGAGAT AGG (reversed) Intergenic
No off target data available for this crispr