ID: 949584598

View in Genome Browser
Species Human (GRCh38)
Location 3:5425420-5425442
Sequence TCCCCTCAGCTGGAGATTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949584598_949584604 8 Left 949584598 3:5425420-5425442 CCAGAAATCTCCAGCTGAGGGGA No data
Right 949584604 3:5425451-5425473 AGGGAGTTGGTTACATGGTGTGG No data
949584598_949584605 9 Left 949584598 3:5425420-5425442 CCAGAAATCTCCAGCTGAGGGGA No data
Right 949584605 3:5425452-5425474 GGGAGTTGGTTACATGGTGTGGG No data
949584598_949584602 -5 Left 949584598 3:5425420-5425442 CCAGAAATCTCCAGCTGAGGGGA No data
Right 949584602 3:5425438-5425460 GGGGAAACAATCAAGGGAGTTGG No data
949584598_949584603 3 Left 949584598 3:5425420-5425442 CCAGAAATCTCCAGCTGAGGGGA No data
Right 949584603 3:5425446-5425468 AATCAAGGGAGTTGGTTACATGG No data
949584598_949584606 16 Left 949584598 3:5425420-5425442 CCAGAAATCTCCAGCTGAGGGGA No data
Right 949584606 3:5425459-5425481 GGTTACATGGTGTGGGAAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949584598 Original CRISPR TCCCCTCAGCTGGAGATTTC TGG (reversed) Intergenic
No off target data available for this crispr