ID: 949588384

View in Genome Browser
Species Human (GRCh38)
Location 3:5466273-5466295
Sequence TAGAAGGCTAAGATTTGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949588381_949588384 -1 Left 949588381 3:5466251-5466273 CCAATGTACTCATTTCACATACT No data
Right 949588384 3:5466273-5466295 TAGAAGGCTAAGATTTGGAGAGG No data
949588380_949588384 0 Left 949588380 3:5466250-5466272 CCCAATGTACTCATTTCACATAC No data
Right 949588384 3:5466273-5466295 TAGAAGGCTAAGATTTGGAGAGG No data
949588379_949588384 7 Left 949588379 3:5466243-5466265 CCTATTTCCCAATGTACTCATTT No data
Right 949588384 3:5466273-5466295 TAGAAGGCTAAGATTTGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949588384 Original CRISPR TAGAAGGCTAAGATTTGGAG AGG Intergenic
No off target data available for this crispr