ID: 949592375

View in Genome Browser
Species Human (GRCh38)
Location 3:5507943-5507965
Sequence ATGGAAAAGGAGACTCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949592371_949592375 -2 Left 949592371 3:5507922-5507944 CCGATGTTTAAAGGATGGGAAAT No data
Right 949592375 3:5507943-5507965 ATGGAAAAGGAGACTCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949592375 Original CRISPR ATGGAAAAGGAGACTCAGGA AGG Intergenic
No off target data available for this crispr