ID: 949596465

View in Genome Browser
Species Human (GRCh38)
Location 3:5553088-5553110
Sequence GCCAGTGCCCTGCTACTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949596465_949596467 -6 Left 949596465 3:5553088-5553110 CCAGCCAGTAGCAGGGCACTGGC No data
Right 949596467 3:5553105-5553127 ACTGGCTCCCAGTCTAGAGCAGG No data
949596465_949596470 8 Left 949596465 3:5553088-5553110 CCAGCCAGTAGCAGGGCACTGGC No data
Right 949596470 3:5553119-5553141 TAGAGCAGGAGCTTTTAACCTGG No data
949596465_949596471 16 Left 949596465 3:5553088-5553110 CCAGCCAGTAGCAGGGCACTGGC No data
Right 949596471 3:5553127-5553149 GAGCTTTTAACCTGGAATCAAGG No data
949596465_949596472 24 Left 949596465 3:5553088-5553110 CCAGCCAGTAGCAGGGCACTGGC No data
Right 949596472 3:5553135-5553157 AACCTGGAATCAAGGATCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949596465 Original CRISPR GCCAGTGCCCTGCTACTGGC TGG (reversed) Intergenic
No off target data available for this crispr