ID: 949596470

View in Genome Browser
Species Human (GRCh38)
Location 3:5553119-5553141
Sequence TAGAGCAGGAGCTTTTAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949596466_949596470 4 Left 949596466 3:5553092-5553114 CCAGTAGCAGGGCACTGGCTCCC No data
Right 949596470 3:5553119-5553141 TAGAGCAGGAGCTTTTAACCTGG No data
949596465_949596470 8 Left 949596465 3:5553088-5553110 CCAGCCAGTAGCAGGGCACTGGC No data
Right 949596470 3:5553119-5553141 TAGAGCAGGAGCTTTTAACCTGG No data
949596460_949596470 28 Left 949596460 3:5553068-5553090 CCTGTACCAGTCAGTACTCTCCA No data
Right 949596470 3:5553119-5553141 TAGAGCAGGAGCTTTTAACCTGG No data
949596461_949596470 22 Left 949596461 3:5553074-5553096 CCAGTCAGTACTCTCCAGCCAGT No data
Right 949596470 3:5553119-5553141 TAGAGCAGGAGCTTTTAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949596470 Original CRISPR TAGAGCAGGAGCTTTTAACC TGG Intergenic
No off target data available for this crispr