ID: 949596471

View in Genome Browser
Species Human (GRCh38)
Location 3:5553127-5553149
Sequence GAGCTTTTAACCTGGAATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949596468_949596471 -8 Left 949596468 3:5553112-5553134 CCCAGTCTAGAGCAGGAGCTTTT No data
Right 949596471 3:5553127-5553149 GAGCTTTTAACCTGGAATCAAGG No data
949596466_949596471 12 Left 949596466 3:5553092-5553114 CCAGTAGCAGGGCACTGGCTCCC No data
Right 949596471 3:5553127-5553149 GAGCTTTTAACCTGGAATCAAGG No data
949596461_949596471 30 Left 949596461 3:5553074-5553096 CCAGTCAGTACTCTCCAGCCAGT No data
Right 949596471 3:5553127-5553149 GAGCTTTTAACCTGGAATCAAGG No data
949596469_949596471 -9 Left 949596469 3:5553113-5553135 CCAGTCTAGAGCAGGAGCTTTTA No data
Right 949596471 3:5553127-5553149 GAGCTTTTAACCTGGAATCAAGG No data
949596465_949596471 16 Left 949596465 3:5553088-5553110 CCAGCCAGTAGCAGGGCACTGGC No data
Right 949596471 3:5553127-5553149 GAGCTTTTAACCTGGAATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949596471 Original CRISPR GAGCTTTTAACCTGGAATCA AGG Intergenic
No off target data available for this crispr