ID: 949596472

View in Genome Browser
Species Human (GRCh38)
Location 3:5553135-5553157
Sequence AACCTGGAATCAAGGATCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949596465_949596472 24 Left 949596465 3:5553088-5553110 CCAGCCAGTAGCAGGGCACTGGC No data
Right 949596472 3:5553135-5553157 AACCTGGAATCAAGGATCTCTGG No data
949596466_949596472 20 Left 949596466 3:5553092-5553114 CCAGTAGCAGGGCACTGGCTCCC No data
Right 949596472 3:5553135-5553157 AACCTGGAATCAAGGATCTCTGG No data
949596468_949596472 0 Left 949596468 3:5553112-5553134 CCCAGTCTAGAGCAGGAGCTTTT No data
Right 949596472 3:5553135-5553157 AACCTGGAATCAAGGATCTCTGG No data
949596469_949596472 -1 Left 949596469 3:5553113-5553135 CCAGTCTAGAGCAGGAGCTTTTA No data
Right 949596472 3:5553135-5553157 AACCTGGAATCAAGGATCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949596472 Original CRISPR AACCTGGAATCAAGGATCTC TGG Intergenic
No off target data available for this crispr