ID: 949601104

View in Genome Browser
Species Human (GRCh38)
Location 3:5598631-5598653
Sequence GTTGACTAACTTGCAAACAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949601102_949601104 -9 Left 949601102 3:5598617-5598639 CCTGCTTGGGATGTGTTGACTAA No data
Right 949601104 3:5598631-5598653 GTTGACTAACTTGCAAACACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949601104 Original CRISPR GTTGACTAACTTGCAAACAC GGG Intergenic
No off target data available for this crispr