ID: 949602426

View in Genome Browser
Species Human (GRCh38)
Location 3:5614754-5614776
Sequence GGATCCAGATGAGCACCAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949602426_949602436 25 Left 949602426 3:5614754-5614776 CCTGTTGGTGCTCATCTGGATCC No data
Right 949602436 3:5614802-5614824 CACATTTTTCTGCTAAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949602426 Original CRISPR GGATCCAGATGAGCACCAAC AGG (reversed) Intergenic
No off target data available for this crispr