ID: 949604589

View in Genome Browser
Species Human (GRCh38)
Location 3:5639136-5639158
Sequence GGGCAGGTTGCTGCAAGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949604580_949604589 15 Left 949604580 3:5639098-5639120 CCCTGGGTTGTTTATTGTATATA No data
Right 949604589 3:5639136-5639158 GGGCAGGTTGCTGCAAGTTCTGG No data
949604579_949604589 26 Left 949604579 3:5639087-5639109 CCAGGTCAGCACCCTGGGTTGTT No data
Right 949604589 3:5639136-5639158 GGGCAGGTTGCTGCAAGTTCTGG No data
949604581_949604589 14 Left 949604581 3:5639099-5639121 CCTGGGTTGTTTATTGTATATAA No data
Right 949604589 3:5639136-5639158 GGGCAGGTTGCTGCAAGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949604589 Original CRISPR GGGCAGGTTGCTGCAAGTTC TGG Intergenic
No off target data available for this crispr