ID: 949606211

View in Genome Browser
Species Human (GRCh38)
Location 3:5657093-5657115
Sequence TTTTTAAAGGGGATCATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949606204_949606211 -1 Left 949606204 3:5657071-5657093 CCCAAGAAGTTCTGGACTGGAGT No data
Right 949606211 3:5657093-5657115 TTTTTAAAGGGGATCATGGAGGG No data
949606205_949606211 -2 Left 949606205 3:5657072-5657094 CCAAGAAGTTCTGGACTGGAGTT No data
Right 949606211 3:5657093-5657115 TTTTTAAAGGGGATCATGGAGGG No data
949606203_949606211 0 Left 949606203 3:5657070-5657092 CCCCAAGAAGTTCTGGACTGGAG No data
Right 949606211 3:5657093-5657115 TTTTTAAAGGGGATCATGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949606211 Original CRISPR TTTTTAAAGGGGATCATGGA GGG Intergenic
No off target data available for this crispr