ID: 949606470

View in Genome Browser
Species Human (GRCh38)
Location 3:5659430-5659452
Sequence CTTGATGGCCAATCTGGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949606470_949606473 -3 Left 949606470 3:5659430-5659452 CCTCTTCCAGATTGGCCATCAAG No data
Right 949606473 3:5659450-5659472 AAGAGCTATAATGAAATAGCAGG No data
949606470_949606474 10 Left 949606470 3:5659430-5659452 CCTCTTCCAGATTGGCCATCAAG No data
Right 949606474 3:5659463-5659485 AAATAGCAGGAAAAAAAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949606470 Original CRISPR CTTGATGGCCAATCTGGAAG AGG (reversed) Intergenic
No off target data available for this crispr