ID: 949609600

View in Genome Browser
Species Human (GRCh38)
Location 3:5690926-5690948
Sequence ATTGGAGGTGTTGCTGCCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949609597_949609600 -6 Left 949609597 3:5690909-5690931 CCAATCTCCAAGTTCATATTGGA No data
Right 949609600 3:5690926-5690948 ATTGGAGGTGTTGCTGCCGCTGG No data
949609594_949609600 28 Left 949609594 3:5690875-5690897 CCTTGGATGGGTTAAAATGGAAG No data
Right 949609600 3:5690926-5690948 ATTGGAGGTGTTGCTGCCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949609600 Original CRISPR ATTGGAGGTGTTGCTGCCGC TGG Intergenic
No off target data available for this crispr