ID: 949610011

View in Genome Browser
Species Human (GRCh38)
Location 3:5694332-5694354
Sequence TACACAGACATGCCTCCAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949610011_949610018 30 Left 949610011 3:5694332-5694354 CCAATTGGAGGCATGTCTGTGTA No data
Right 949610018 3:5694385-5694407 GCCTGGACTCCTTCCCCCAAGGG No data
949610011_949610017 29 Left 949610011 3:5694332-5694354 CCAATTGGAGGCATGTCTGTGTA No data
Right 949610017 3:5694384-5694406 AGCCTGGACTCCTTCCCCCAAGG No data
949610011_949610013 -4 Left 949610011 3:5694332-5694354 CCAATTGGAGGCATGTCTGTGTA No data
Right 949610013 3:5694351-5694373 TGTAATCAATGTGGATACTTTGG No data
949610011_949610015 13 Left 949610011 3:5694332-5694354 CCAATTGGAGGCATGTCTGTGTA No data
Right 949610015 3:5694368-5694390 CTTTGGAATGGCCTTAAGCCTGG No data
949610011_949610014 1 Left 949610011 3:5694332-5694354 CCAATTGGAGGCATGTCTGTGTA No data
Right 949610014 3:5694356-5694378 TCAATGTGGATACTTTGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949610011 Original CRISPR TACACAGACATGCCTCCAAT TGG (reversed) Intergenic
No off target data available for this crispr