ID: 949610013

View in Genome Browser
Species Human (GRCh38)
Location 3:5694351-5694373
Sequence TGTAATCAATGTGGATACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949610011_949610013 -4 Left 949610011 3:5694332-5694354 CCAATTGGAGGCATGTCTGTGTA No data
Right 949610013 3:5694351-5694373 TGTAATCAATGTGGATACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949610013 Original CRISPR TGTAATCAATGTGGATACTT TGG Intergenic
No off target data available for this crispr