ID: 949610017

View in Genome Browser
Species Human (GRCh38)
Location 3:5694384-5694406
Sequence AGCCTGGACTCCTTCCCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949610011_949610017 29 Left 949610011 3:5694332-5694354 CCAATTGGAGGCATGTCTGTGTA No data
Right 949610017 3:5694384-5694406 AGCCTGGACTCCTTCCCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949610017 Original CRISPR AGCCTGGACTCCTTCCCCCA AGG Intergenic
No off target data available for this crispr