ID: 949610162

View in Genome Browser
Species Human (GRCh38)
Location 3:5696084-5696106
Sequence ACCTAGGAGAAACTCCCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949610162_949610166 -3 Left 949610162 3:5696084-5696106 CCTGAAGGGAGTTTCTCCTAGGT No data
Right 949610166 3:5696104-5696126 GGTCTGGTCGGACCTTTGTATGG 0: 41
1: 115
2: 101
3: 52
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949610162 Original CRISPR ACCTAGGAGAAACTCCCTTC AGG (reversed) Intergenic
No off target data available for this crispr