ID: 949618333

View in Genome Browser
Species Human (GRCh38)
Location 3:5781461-5781483
Sequence GCATTTGAATTGGTGGACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949618333_949618336 -10 Left 949618333 3:5781461-5781483 CCTTGGTCCACCAATTCAAATGC No data
Right 949618336 3:5781474-5781496 ATTCAAATGCTAACCTGTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949618333 Original CRISPR GCATTTGAATTGGTGGACCA AGG (reversed) Intergenic
No off target data available for this crispr