ID: 949621020

View in Genome Browser
Species Human (GRCh38)
Location 3:5811659-5811681
Sequence CCCACTTGGTACTAGATCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949621012_949621020 19 Left 949621012 3:5811617-5811639 CCAAGGATTGATGGAATCCAAGT No data
Right 949621020 3:5811659-5811681 CCCACTTGGTACTAGATCCCTGG No data
949621010_949621020 26 Left 949621010 3:5811610-5811632 CCCTTATCCAAGGATTGATGGAA No data
Right 949621020 3:5811659-5811681 CCCACTTGGTACTAGATCCCTGG No data
949621013_949621020 2 Left 949621013 3:5811634-5811656 CCAAGTCATTCTCCTTCCCATCA No data
Right 949621020 3:5811659-5811681 CCCACTTGGTACTAGATCCCTGG No data
949621011_949621020 25 Left 949621011 3:5811611-5811633 CCTTATCCAAGGATTGATGGAAT No data
Right 949621020 3:5811659-5811681 CCCACTTGGTACTAGATCCCTGG No data
949621015_949621020 -10 Left 949621015 3:5811646-5811668 CCTTCCCATCAGCCCCACTTGGT No data
Right 949621020 3:5811659-5811681 CCCACTTGGTACTAGATCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949621020 Original CRISPR CCCACTTGGTACTAGATCCC TGG Intergenic
No off target data available for this crispr