ID: 949621581

View in Genome Browser
Species Human (GRCh38)
Location 3:5818711-5818733
Sequence TCACTTGTGTTTTCAGCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949621575_949621581 25 Left 949621575 3:5818663-5818685 CCATTGGTTAAGGGTGGCTCCAC No data
Right 949621581 3:5818711-5818733 TCACTTGTGTTTTCAGCCTGGGG No data
949621577_949621581 6 Left 949621577 3:5818682-5818704 CCACAGGCATCAATCACTATGTT No data
Right 949621581 3:5818711-5818733 TCACTTGTGTTTTCAGCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949621581 Original CRISPR TCACTTGTGTTTTCAGCCTG GGG Intergenic
No off target data available for this crispr