ID: 949626410

View in Genome Browser
Species Human (GRCh38)
Location 3:5871737-5871759
Sequence TCTTACATGGGCACGGTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949626410_949626416 30 Left 949626410 3:5871737-5871759 CCACAAACCGTGCCCATGTAAGA No data
Right 949626416 3:5871790-5871812 GTTCTGACTGCTCCACTAATAGG 0: 3
1: 22
2: 170
3: 285
4: 444

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949626410 Original CRISPR TCTTACATGGGCACGGTTTG TGG (reversed) Intergenic
No off target data available for this crispr