ID: 949626410 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:5871737-5871759 |
| Sequence | TCTTACATGGGCACGGTTTG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 949626410_949626416 | 30 | Left | 949626410 | 3:5871737-5871759 | CCACAAACCGTGCCCATGTAAGA | No data | ||
| Right | 949626416 | 3:5871790-5871812 | GTTCTGACTGCTCCACTAATAGG | 0: 3 1: 22 2: 170 3: 285 4: 444 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 949626410 | Original CRISPR | TCTTACATGGGCACGGTTTG TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||