ID: 949628125

View in Genome Browser
Species Human (GRCh38)
Location 3:5891088-5891110
Sequence CAGAGGAATTAGGATGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949628125_949628128 2 Left 949628125 3:5891088-5891110 CCATCTTCATCCTAATTCCTCTG No data
Right 949628128 3:5891113-5891135 AGATTCATATTCTTAGAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949628125 Original CRISPR CAGAGGAATTAGGATGAAGA TGG (reversed) Intergenic
No off target data available for this crispr