ID: 949628148

View in Genome Browser
Species Human (GRCh38)
Location 3:5891289-5891311
Sequence AAGAAAAAAAAAATACGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949628148_949628151 20 Left 949628148 3:5891289-5891311 CCTCCACGTATTTTTTTTTTCTT No data
Right 949628151 3:5891332-5891354 TCCTCTTCTCTTACAGCTGTGGG No data
949628148_949628154 27 Left 949628148 3:5891289-5891311 CCTCCACGTATTTTTTTTTTCTT No data
Right 949628154 3:5891339-5891361 CTCTTACAGCTGTGGGACTAGGG No data
949628148_949628150 19 Left 949628148 3:5891289-5891311 CCTCCACGTATTTTTTTTTTCTT No data
Right 949628150 3:5891331-5891353 GTCCTCTTCTCTTACAGCTGTGG No data
949628148_949628153 26 Left 949628148 3:5891289-5891311 CCTCCACGTATTTTTTTTTTCTT No data
Right 949628153 3:5891338-5891360 TCTCTTACAGCTGTGGGACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949628148 Original CRISPR AAGAAAAAAAAAATACGTGG AGG (reversed) Intergenic