ID: 949628149

View in Genome Browser
Species Human (GRCh38)
Location 3:5891292-5891314
Sequence AAGAAGAAAAAAAAAATACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949628149_949628153 23 Left 949628149 3:5891292-5891314 CCACGTATTTTTTTTTTCTTCTT No data
Right 949628153 3:5891338-5891360 TCTCTTACAGCTGTGGGACTAGG No data
949628149_949628154 24 Left 949628149 3:5891292-5891314 CCACGTATTTTTTTTTTCTTCTT No data
Right 949628154 3:5891339-5891361 CTCTTACAGCTGTGGGACTAGGG No data
949628149_949628151 17 Left 949628149 3:5891292-5891314 CCACGTATTTTTTTTTTCTTCTT No data
Right 949628151 3:5891332-5891354 TCCTCTTCTCTTACAGCTGTGGG No data
949628149_949628150 16 Left 949628149 3:5891292-5891314 CCACGTATTTTTTTTTTCTTCTT No data
Right 949628150 3:5891331-5891353 GTCCTCTTCTCTTACAGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949628149 Original CRISPR AAGAAGAAAAAAAAAATACG TGG (reversed) Intergenic
No off target data available for this crispr