ID: 949628154

View in Genome Browser
Species Human (GRCh38)
Location 3:5891339-5891361
Sequence CTCTTACAGCTGTGGGACTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949628149_949628154 24 Left 949628149 3:5891292-5891314 CCACGTATTTTTTTTTTCTTCTT No data
Right 949628154 3:5891339-5891361 CTCTTACAGCTGTGGGACTAGGG No data
949628148_949628154 27 Left 949628148 3:5891289-5891311 CCTCCACGTATTTTTTTTTTCTT No data
Right 949628154 3:5891339-5891361 CTCTTACAGCTGTGGGACTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949628154 Original CRISPR CTCTTACAGCTGTGGGACTA GGG Intergenic
No off target data available for this crispr