ID: 949637634

View in Genome Browser
Species Human (GRCh38)
Location 3:6000754-6000776
Sequence CACTGAAAAGTATCAGGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949637634_949637640 13 Left 949637634 3:6000754-6000776 CCACTTCCTGATACTTTTCAGTG No data
Right 949637640 3:6000790-6000812 TTTTTGGTGACATCTTCTGTGGG No data
949637634_949637636 -3 Left 949637634 3:6000754-6000776 CCACTTCCTGATACTTTTCAGTG No data
Right 949637636 3:6000774-6000796 GTGCCAAGCTGACCTATTTTTGG No data
949637634_949637639 12 Left 949637634 3:6000754-6000776 CCACTTCCTGATACTTTTCAGTG No data
Right 949637639 3:6000789-6000811 ATTTTTGGTGACATCTTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949637634 Original CRISPR CACTGAAAAGTATCAGGAAG TGG (reversed) Intergenic