ID: 949637634 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:6000754-6000776 |
| Sequence | CACTGAAAAGTATCAGGAAG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 949637634_949637640 | 13 | Left | 949637634 | 3:6000754-6000776 | CCACTTCCTGATACTTTTCAGTG | No data | ||
| Right | 949637640 | 3:6000790-6000812 | TTTTTGGTGACATCTTCTGTGGG | No data | ||||
| 949637634_949637636 | -3 | Left | 949637634 | 3:6000754-6000776 | CCACTTCCTGATACTTTTCAGTG | No data | ||
| Right | 949637636 | 3:6000774-6000796 | GTGCCAAGCTGACCTATTTTTGG | No data | ||||
| 949637634_949637639 | 12 | Left | 949637634 | 3:6000754-6000776 | CCACTTCCTGATACTTTTCAGTG | No data | ||
| Right | 949637639 | 3:6000789-6000811 | ATTTTTGGTGACATCTTCTGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 949637634 | Original CRISPR | CACTGAAAAGTATCAGGAAG TGG (reversed) | Intergenic | ||