ID: 949637635

View in Genome Browser
Species Human (GRCh38)
Location 3:6000760-6000782
Sequence GCTTGGCACTGAAAAGTATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949637635_949637640 7 Left 949637635 3:6000760-6000782 CCTGATACTTTTCAGTGCCAAGC No data
Right 949637640 3:6000790-6000812 TTTTTGGTGACATCTTCTGTGGG No data
949637635_949637636 -9 Left 949637635 3:6000760-6000782 CCTGATACTTTTCAGTGCCAAGC No data
Right 949637636 3:6000774-6000796 GTGCCAAGCTGACCTATTTTTGG No data
949637635_949637639 6 Left 949637635 3:6000760-6000782 CCTGATACTTTTCAGTGCCAAGC No data
Right 949637639 3:6000789-6000811 ATTTTTGGTGACATCTTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949637635 Original CRISPR GCTTGGCACTGAAAAGTATC AGG (reversed) Intergenic
No off target data available for this crispr