ID: 949637636

View in Genome Browser
Species Human (GRCh38)
Location 3:6000774-6000796
Sequence GTGCCAAGCTGACCTATTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949637634_949637636 -3 Left 949637634 3:6000754-6000776 CCACTTCCTGATACTTTTCAGTG No data
Right 949637636 3:6000774-6000796 GTGCCAAGCTGACCTATTTTTGG No data
949637635_949637636 -9 Left 949637635 3:6000760-6000782 CCTGATACTTTTCAGTGCCAAGC No data
Right 949637636 3:6000774-6000796 GTGCCAAGCTGACCTATTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949637636 Original CRISPR GTGCCAAGCTGACCTATTTT TGG Intergenic
No off target data available for this crispr