ID: 949637637 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:6000777-6000799 |
Sequence | TCACCAAAAATAGGTCAGCT TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
949637637_949637640 | -10 | Left | 949637637 | 3:6000777-6000799 | CCAAGCTGACCTATTTTTGGTGA | No data | ||
Right | 949637640 | 3:6000790-6000812 | TTTTTGGTGACATCTTCTGTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
949637637 | Original CRISPR | TCACCAAAAATAGGTCAGCT TGG (reversed) | Intergenic | ||