ID: 949637637

View in Genome Browser
Species Human (GRCh38)
Location 3:6000777-6000799
Sequence TCACCAAAAATAGGTCAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949637637_949637640 -10 Left 949637637 3:6000777-6000799 CCAAGCTGACCTATTTTTGGTGA No data
Right 949637640 3:6000790-6000812 TTTTTGGTGACATCTTCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949637637 Original CRISPR TCACCAAAAATAGGTCAGCT TGG (reversed) Intergenic