ID: 949637639

View in Genome Browser
Species Human (GRCh38)
Location 3:6000789-6000811
Sequence ATTTTTGGTGACATCTTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949637634_949637639 12 Left 949637634 3:6000754-6000776 CCACTTCCTGATACTTTTCAGTG No data
Right 949637639 3:6000789-6000811 ATTTTTGGTGACATCTTCTGTGG No data
949637635_949637639 6 Left 949637635 3:6000760-6000782 CCTGATACTTTTCAGTGCCAAGC No data
Right 949637639 3:6000789-6000811 ATTTTTGGTGACATCTTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949637639 Original CRISPR ATTTTTGGTGACATCTTCTG TGG Intergenic
No off target data available for this crispr