ID: 949637640

View in Genome Browser
Species Human (GRCh38)
Location 3:6000790-6000812
Sequence TTTTTGGTGACATCTTCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949637635_949637640 7 Left 949637635 3:6000760-6000782 CCTGATACTTTTCAGTGCCAAGC No data
Right 949637640 3:6000790-6000812 TTTTTGGTGACATCTTCTGTGGG No data
949637634_949637640 13 Left 949637634 3:6000754-6000776 CCACTTCCTGATACTTTTCAGTG No data
Right 949637640 3:6000790-6000812 TTTTTGGTGACATCTTCTGTGGG No data
949637637_949637640 -10 Left 949637637 3:6000777-6000799 CCAAGCTGACCTATTTTTGGTGA No data
Right 949637640 3:6000790-6000812 TTTTTGGTGACATCTTCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949637640 Original CRISPR TTTTTGGTGACATCTTCTGT GGG Intergenic