ID: 949637784

View in Genome Browser
Species Human (GRCh38)
Location 3:6002915-6002937
Sequence GAGAAAACCCACAATTCAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
949637783_949637784 3 Left 949637783 3:6002889-6002911 CCAGTATAATAAAATAAGAAATC No data
Right 949637784 3:6002915-6002937 GAGAAAACCCACAATTCAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
949637784 Original CRISPR GAGAAAACCCACAATTCAAT AGG Intergenic
No off target data available for this crispr